Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8061612.1

Orthogroup ID

OG0020389

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 569

Gene Structure 569 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8061612.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 233 bp

gttttggaaatagagacacagatgagctcagctacagaaaaattgggattccaaagggcaagatttttataatcaatcccaagggtgaggtggccatcagccatcatcgtgctggtgatgtgaagtcgtatacatctttacatactcttgtcaatgacatgtttcctccaacttcattggttgagcaggaagattttaactcatggaactattggagactgccgttgccagaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000139 GO:0000322 GO:0000325 GO:0000326 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005774 GO:0005794 GO:0005829 GO:0006629 GO:0006643 GO:0006644 GO:0006664 GO:0006793 GO:0006796 GO:0006810 GO:0006886 GO:0006950 GO:0007154 GO:0008104 GO:0008150 GO:0008152 GO:0008610 GO:0008654 GO:0009058 GO:0009247 GO:0009267 GO:0009605 GO:0009705 GO:0009987 GO:0009991 GO:0012505 GO:0015031 GO:0015833 GO:0016020 GO:0016036 GO:0019374 GO:0019375 GO:0019637 GO:0031090 GO:0031667 GO:0031668 GO:0031669 GO:0031984 GO:0032586 GO:0033036 GO:0033554 GO:0034613 GO:0042594 GO:0042886 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044249 GO:0044255 GO:0044422 GO:0044424 GO:0044431 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0045184 GO:0046467 GO:0046907 GO:0050896 GO:0051179 GO:0051234 GO:0051641 GO:0051649 GO:0051716 GO:0070727 GO:0071496 GO:0071702 GO:0071704 GO:0071705 GO:0090407 GO:0098588 GO:0098791 GO:0098805 GO:1901135 GO:1901137 GO:1901576 GO:1903509

KEGG Pathways

Metabolic & Signaling

ko00561 ko00564 ko01100 ko01110 map00561 map00564 map01100 map01110

Pfam Domains

Protein Families

LNS2 Lipin_N Lipin_mid

Protein Analysis

77

Amino Acids

8.89

Weight (kDa)

6.32

Isoelectric Point (pI)

12.86

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020389)

Species	Orthologous Gene IDs
malus_domestica	MD08G1102500.v1.1
rosa_chinensis	RchiOBHm_Chr5g0048511
rosa_multiflora	Rmu_co8061612.1_g000001
rosa_roxburghii	Rroxscaffold_1G00033290
rosa_wichuraiana	Rw5G029820 Rw5G029950

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	70
AccI	GTMKAC	1 cut(s)	130
AcoI	YGGCCR	1 cut(s)	92
AflIII	ACRYGT	1 cut(s)	158
AluBI	AGCT	2 cut(s)	27, 32
AluI	AGCT	2 cut(s)	27, 32
Alw21I	GWGCWC	1 cut(s)	29
Alw26I	GTCTC	2 cut(s)	8, 210
AoxI	GGCC	1 cut(s)	92
AsuHPI	GGTGA	2 cut(s)	97, 127
BalI	TGGCCA	1 cut(s)	94
BanII	GRGCYC	1 cut(s)	29
Bbv12I	GWGCWC	1 cut(s)	29
BccI	CCATC	2 cut(s)	103, 110
BceAI	ACGGC	1 cut(s)	207
BcoDI	GTCTC	2 cut(s)	8, 210
BfmI	CTRYAG	1 cut(s)	33
BlpI	GCTNAGC	1 cut(s)	28
Bpu1102I	GCTNAGC	1 cut(s)	28
BsaJI	CCNNGG	1 cut(s)	80
BseDI	CCNNGG	1 cut(s)	80
BseMII	CTCAG	1 cut(s)	42
BshFI	GGCC	1 cut(s)	94
BsiHKAI	GWGCWC	1 cut(s)	29
BsmAI	GTCTC	2 cut(s)	8, 210
BsnI	GGCC	1 cut(s)	94
Bsp1286I	GDGCHC	1 cut(s)	29
Bsp1720I	GCTNAGC	1 cut(s)	28
BspANI	GGCC	1 cut(s)	94
BspCNI	CTCAG	1 cut(s)	41
BssECI	CCNNGG	1 cut(s)	80
BssNAI	GTATAC	1 cut(s)	131
BssT1I	CCWWGG	1 cut(s)	80
Bst1107I	GTATAC	1 cut(s)	131
BstDEI	CTNAG	1 cut(s)	28
BstMAI	GTCTC	2 cut(s)	8, 210
BstNSI	RCATGY	1 cut(s)	162
BstSFI	CTRYAG	1 cut(s)	33
BstZ17I	GTATAC	1 cut(s)	131
BsuRI	GGCC	1 cut(s)	94
CviAII	CATG	2 cut(s)	159, 203
CviJI	RGCY	4 cut(s)	27, 32, 94, 101
CviKI_1	RGCY	4 cut(s)	27, 32, 94, 101
DdeI	CTNAG	1 cut(s)	28
EaeI	YGGCCR	1 cut(s)	92
Ecl136II	GAGCTC	1 cut(s)	27
Eco130I	CCWWGG	1 cut(s)	80
Eco24I	GRGCYC	1 cut(s)	29
Eco53kI	GAGCTC	1 cut(s)	27
EcoICRI	GAGCTC	1 cut(s)	27
EcoT14I	CCWWGG	1 cut(s)	80
EcoT38I	GRGCYC	1 cut(s)	29
ErhI	CCWWGG	1 cut(s)	80
FaeI	CATG	2 cut(s)	162, 206
FaiI	YATR	5 cut(s)	70, 131, 143, 160, 204
FatI	CATG	2 cut(s)	158, 202
FblI	GTMKAC	1 cut(s)	130
FriOI	GRGCYC	1 cut(s)	29
HaeIII	GGCC	1 cut(s)	94
Hin1II	CATG	2 cut(s)	162, 206
HinfI	GANTC	1 cut(s)	48
HphI	GGTGA	2 cut(s)	97, 127
Hpy166II	GTNNAC	1 cut(s)	131
Hpy8I	GTNNAC	1 cut(s)	131
HpyF3I	CTNAG	1 cut(s)	28
Hsp92II	CATG	2 cut(s)	162, 206
LpnPI	CCDG	2 cut(s)	98, 172
MboII	GAAGA	1 cut(s)	202
MhlI	GDGCHC	1 cut(s)	29
MlsI	TGGCCA	1 cut(s)	94
MluCI	AATT	1 cut(s)	41
MluNI	TGGCCA	1 cut(s)	94
MmeI	TCCRAC	1 cut(s)	193
MnlI	CCTC	2 cut(s)	81, 176
Mox20I	TGGCCA	1 cut(s)	94
MscI	TGGCCA	1 cut(s)	94
MseI	TTAA	1 cut(s)	197
MslI	CAYNNNNRTG	1 cut(s)	107
Msp20I	TGGCCA	1 cut(s)	94
NlaIII	CATG	2 cut(s)	162, 206
NspI	RCATGY	1 cut(s)	162
PciI	ACATGT	1 cut(s)	158
PfeI	GAWTC	1 cut(s)	48
PscI	ACATGT	1 cut(s)	158
PsiI	TTATAA	1 cut(s)	70
Psp124BI	GAGCTC	1 cut(s)	29
RseI	CAYNNNNRTG	1 cut(s)	107
SacI	GAGCTC	1 cut(s)	29
SaqAI	TTAA	1 cut(s)	197
SduI	GDGCHC	1 cut(s)	29
SetI	ASST	3 cut(s)	29, 34, 92
SfcI	CTRYAG	1 cut(s)	33
SgeI	CNNG	8 cut(s)	72, 93, 121, 125, 160, 171, 199, 215
SmiMI	CAYNNNNRTG	1 cut(s)	107
Sse9I	AATT	1 cut(s)	41
SstI	GAGCTC	1 cut(s)	29
StyI	CCWWGG	1 cut(s)	80
TasI	AATT	1 cut(s)	41
TfiI	GAWTC	1 cut(s)	48
Tru1I	TTAA	1 cut(s)	197
Tru9I	TTAA	1 cut(s)	197
TspDTI	ATGAA	1 cut(s)	164
XceI	RCATGY	1 cut(s)	162
XcmI	CCANNNNNNNNNTGG	2 cut(s)	87, 109
XmiI	GTMKAC	1 cut(s)	130

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.