Rmu_co8185098.1_g000001

Lysosomal beta

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8185098.1
Physical Location & Seq
Forward (+)
1 .. 691
691 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8185098.1_g000001.1.cds

Sequence Viewer

Length: 377 bp
taaaaaggttgcagcctgtgcaaagcattatgtgggcgatggtggaacaaccaaaggcatcgatgaggataacactgtaataaacaggcatgggttactcagcattcacatgccaccctactataactcaattatcgaaggtgttgcaaccattatggtatcttactccagctggaatggagtcaagatgcatgctaaccgtgatcttgtcactggctttcttaagaatactctccgtttcaggggttttgtcatctcagatttcatgggtattgacagaattacctcaccagcttatgccaactactcatactcgattacagcagggatcaatgctggcattgacatggtaataattattgtccatctccatctgc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

125

Amino Acids

13.73

Weight (kDa)

8.75

Isoelectric Point (pI)

36.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019805)

Species Orthologous Gene IDs
prunus_persica Prupe.7G006800_v2.0.a1
pyrus_communis pycom14g00280
rosa_chinensis RchiOBHm_Chr5g0049451
rosa_multiflora Rmu_co8185098.1_g000001
rosa_samantha Rh5BG336100 Rh5BG336200 Rh5DG348400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 336
AfiI CCNNNNNNNGG 1 cut(s) 242
AflII CTTAAG 1 cut(s) 222
AluBI AGCT 2 cut(s) 172, 294
AluI AGCT 2 cut(s) 172, 294
AlwI GGATC 1 cut(s) 336
ApeKI GCWGC 1 cut(s) 12
AsuHPI GGTGA 1 cut(s) 280
BbvI GCAGC 1 cut(s) 24
BccI CCATC 2 cut(s) 33, 373
BcgI CGANNNNNNTGC 2 cut(s) 126, 160
BfrI CTTAAG 1 cut(s) 222
BisI GCNGC 1 cut(s) 13
BlsI GCNGC 1 cut(s) 14
BmsI GCATC 2 cut(s) 67, 178
BpmI CTGGAG 1 cut(s) 152
Bsa29I ATCGAT 1 cut(s) 61
Bsc4I CCNNNNNNNGG 1 cut(s) 242
Bse1I ACTGG 1 cut(s) 218
BseCI ATCGAT 1 cut(s) 61
BseLI CCNNNNNNNGG 1 cut(s) 242
BseMII CTCAG 2 cut(s) 113, 271
BseNI ACTGG 1 cut(s) 218
BseXI GCAGC 1 cut(s) 24
BshVI ATCGAT 1 cut(s) 61
BslI CCNNNNNNNGG 1 cut(s) 242
BsmI GAATGC 1 cut(s) 103
Bsp143I GATC 2 cut(s) 203, 328
BspCNI CTCAG 2 cut(s) 112, 270
BspDI ATCGAT 1 cut(s) 61
BspPI GGATC 1 cut(s) 336
BspTI CTTAAG 1 cut(s) 222
BsrI ACTGG 1 cut(s) 218
BssMI GATC 2 cut(s) 203, 328
Bst4CI ACNGT 2 cut(s) 77, 201
BstAFI CTTAAG 1 cut(s) 222
BstAPI GCANNNNNTGC 1 cut(s) 18
BstC8I GCNNGC 2 cut(s) 193, 338
BstDEI CTNAG 2 cut(s) 99, 257
BstKTI GATC 2 cut(s) 206, 331
BstMBI GATC 2 cut(s) 203, 328
BstMWI GCNNNNNNNGC 1 cut(s) 18
BstNSI RCATGY 2 cut(s) 113, 195
BstV1I GCAGC 1 cut(s) 24
Bsu15I ATCGAT 1 cut(s) 61
BsuTUI ATCGAT 1 cut(s) 61
BtgZI GCGATG 1 cut(s) 52
BtsIMutI CAGTG 2 cut(s) 73, 211
Cac8I GCNNGC 2 cut(s) 193, 338
ClaI ATCGAT 1 cut(s) 61
CviAII CATG 5 cut(s) 90, 110, 192, 266, 347
CviJI RGCY 4 cut(s) 15, 172, 217, 294
CviKI_1 RGCY 4 cut(s) 15, 172, 217, 294
DdeI CTNAG 2 cut(s) 99, 257
DpnI GATC 2 cut(s) 205, 330
DpnII GATC 2 cut(s) 203, 328
EcoT22I ATGCAT 1 cut(s) 193
FaeI CATG 5 cut(s) 93, 113, 195, 269, 350
FatI CATG 5 cut(s) 89, 109, 191, 265, 346
Fnu4HI GCNGC 1 cut(s) 13
Fsp4HI GCNGC 1 cut(s) 13
GluI GCNGC 1 cut(s) 13
GsuI CTGGAG 1 cut(s) 152
Hin1II CATG 5 cut(s) 93, 113, 195, 269, 350
HinfI GANTC 1 cut(s) 181
HphI GGTGA 1 cut(s) 280
Hpy188I TCNGA 1 cut(s) 260
Hpy188III TCNNGA 1 cut(s) 185
HpyAV CCTTC 1 cut(s) 132
HpyCH4III ACNGT 2 cut(s) 77, 201
HpyCH4V TGCA 4 cut(s) 12, 21, 147, 191
HpyF10VI GCNNNNNNNGC 1 cut(s) 18
HpyF3I CTNAG 2 cut(s) 99, 257
Hsp92II CATG 5 cut(s) 93, 113, 195, 269, 350
Kzo9I GATC 2 cut(s) 203, 328
LpnPI CCDG 9 cut(s) 29, 71, 158, 182, 199, 227, 304, 310, 322
Lsp1109I GCAGC 1 cut(s) 24
LweI GCATC 2 cut(s) 67, 178
MaeIII GTNAC 2 cut(s) 94, 209
MalI GATC 2 cut(s) 205, 330
MboI GATC 2 cut(s) 203, 328
MluCI AATT 3 cut(s) 130, 280, 355
MlyI GAGTC 1 cut(s) 190
MnlI CCTC 2 cut(s) 59, 296
Mph1103I ATGCAT 1 cut(s) 193
MseI TTAA 1 cut(s) 223
MslI CAYNNNNRTG 2 cut(s) 108, 345
MspA1I CMGCKG 1 cut(s) 172
MspCI CTTAAG 1 cut(s) 222
Mva1269I GAATGC 1 cut(s) 103
MwoI GCNNNNNNNGC 1 cut(s) 18
NdeII GATC 2 cut(s) 203, 328
NlaIII CATG 5 cut(s) 93, 113, 195, 269, 350
NmuCI GTSAC 1 cut(s) 209
NsiI ATGCAT 1 cut(s) 193
NspI RCATGY 2 cut(s) 113, 195
PaeI GCATGC 1 cut(s) 195
PctI GAATGC 1 cut(s) 103
PkrI GCNGC 1 cut(s) 14
PleI GAGTC 1 cut(s) 189
PpsI GAGTC 1 cut(s) 189
PvuII CAGCTG 1 cut(s) 172
RseI CAYNNNNRTG 2 cut(s) 108, 345
SaqAI TTAA 1 cut(s) 223
SatI GCNGC 1 cut(s) 13
Sau3AI GATC 2 cut(s) 203, 328
SchI GAGTC 1 cut(s) 190
SetI ASST 5 cut(s) 10, 143, 174, 288, 296
SfaNI GCATC 2 cut(s) 67, 178
SmiMI CAYNNNNRTG 2 cut(s) 108, 345
SmlI CTYRAG 1 cut(s) 222
SmoI CTYRAG 1 cut(s) 222
SphI GCATGC 1 cut(s) 195
Sse9I AATT 3 cut(s) 130, 280, 355
TaaI ACNGT 2 cut(s) 77, 201
TaqI TCGA 3 cut(s) 61, 136, 315
TasI AATT 3 cut(s) 130, 280, 355
Tru1I TTAA 1 cut(s) 223
Tru9I TTAA 1 cut(s) 223
TscAI CASTG 2 cut(s) 80, 218
TseFI GTSAC 1 cut(s) 209
TseI GCWGC 1 cut(s) 12
Tsp45I GTSAC 1 cut(s) 209
TspDTI ATGAA 1 cut(s) 254
TspGWI ACGGA 1 cut(s) 225
TspRI CASTG 2 cut(s) 80, 218
Vha464I CTTAAG 1 cut(s) 222
XceI RCATGY 2 cut(s) 113, 195
Zsp2I ATGCAT 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.