Rh5BG336200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
46866474 .. 46873177
6704 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG336200.1

Sequence Viewer

Length: 504 bp
ATGCTTCGCCCGCCAGGCTTCATCCGCCAAGCTCTCCTCGGACAAGCTTCATCTGCTGAGCTTTCCAGGACAAGCTTCGTCCGCCAAGCTCTCCTCGGCCAAGCTTCGTCCACCTGGCTCTCCTCGGCCAAGCTTCGTCCGTCCAGCTCTCCTCGGCCAAGCTTCGTCCACCTGGCTCTCCTCGGCCAAGCTTCGTCCGTCCAGCTCTCCTCGGCCAAGATTTGTGCGTCCAGCTCTCCTCGGCCAAGATTCGTGCGTCCAACTCTCCTCGGCCAAGCTTCATCCTCCCAGCTCTCCTCAGCCAAGCTTCGTCCGCCCAGCTTTTCTCAGCCAAGCTTCGTTTGCCAAGCTTTCCTCGGACAAGCTTCGTCCGCCAAGCTCTCCTCGGCCAAGCTTCGTCCGCCAAGCTCTCCTCGGACAAGCTTCGCCCTCCAAACTTTCCTCGGACTAGCTTCGTCCGCCAAGGTTTCCTCCGACAAGGAGACAAGATGCGAATTTTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

167

Amino Acids

17.72

Weight (kDa)

11.67

Isoelectric Point (pI)

64.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019805)

Species Orthologous Gene IDs
prunus_persica Prupe.7G006800_v2.0.a1
pyrus_communis pycom14g00280
rosa_chinensis RchiOBHm_Chr5g0049451
rosa_multiflora Rmu_co8185098.1_g000001
rosa_samantha Rh5BG336100 Rh5BG336200 Rh5DG348400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 7 cut(s) 11, 25, 82, 314, 372, 401, 459
AcoI YGGCCR 8 cut(s) 97, 126, 155, 184, 213, 242, 271, 387
AcsI RAATTY 1 cut(s) 494
AjnI CCWGG 4 cut(s) 13, 65, 113, 171
Alw26I GTCTC 1 cut(s) 476
AoxI GGCC 8 cut(s) 97, 126, 155, 184, 213, 242, 271, 387
ApoI RAATTY 1 cut(s) 494
BbvCI CCTCAGC 1 cut(s) 298
BciT130I CCWGG 4 cut(s) 15, 67, 115, 173
BcoDI GTCTC 1 cut(s) 476
BfaI CTAG 1 cut(s) 449
BglI GCCNNNNNGGC 1 cut(s) 15
BlpI GCTNAGC 1 cut(s) 57
Bme1390I CCNGG 4 cut(s) 15, 67, 115, 173
BmrFI CCNGG 4 cut(s) 15, 67, 115, 173
BmsI GCATC 1 cut(s) 479
Bpu10I CCTNAGC 1 cut(s) 298
Bpu1102I GCTNAGC 1 cut(s) 57
BseBI CCWGG 4 cut(s) 15, 67, 115, 173
BseGI GGATG 2 cut(s) 21, 281
BseMII CTCAG 3 cut(s) 48, 312, 341
BseYI CCCAGC 2 cut(s) 288, 317
BshFI GGCC 8 cut(s) 99, 128, 157, 186, 215, 244, 273, 389
BsmAI GTCTC 1 cut(s) 476
BsnI GGCC 8 cut(s) 99, 128, 157, 186, 215, 244, 273, 389
Bsp1720I GCTNAGC 1 cut(s) 57
BspACI CCGC 7 cut(s) 11, 25, 82, 314, 372, 401, 459
BspANI GGCC 8 cut(s) 99, 128, 157, 186, 215, 244, 273, 389
BspCNI CTCAG 3 cut(s) 49, 311, 340
BssT1I CCWWGG 1 cut(s) 462
Bst2UI CCWGG 4 cut(s) 15, 67, 115, 173
BstC8I GCNNGC 1 cut(s) 11
BstDEI CTNAG 3 cut(s) 57, 298, 327
BstF5I GGATG 2 cut(s) 21, 281
BstMAI GTCTC 1 cut(s) 476
BstNI CCWGG 4 cut(s) 15, 67, 115, 173
BstSCI CCNGG 4 cut(s) 13, 65, 113, 171
BsuRI GGCC 8 cut(s) 99, 128, 157, 186, 215, 244, 273, 389
BtsCI GGATG 2 cut(s) 21, 281
Cac8I GCNNGC 1 cut(s) 11
CseI GACGC 2 cut(s) 216, 245
DdeI CTNAG 3 cut(s) 57, 298, 327
EaeI YGGCCR 8 cut(s) 97, 126, 155, 184, 213, 242, 271, 387
EciI GGCGGA 6 cut(s) 14, 71, 303, 361, 390, 448
Eco130I CCWWGG 1 cut(s) 462
EcoRII CCWGG 4 cut(s) 13, 65, 113, 171
EcoT14I CCWWGG 1 cut(s) 462
ErhI CCWWGG 1 cut(s) 462
FauI CCCGC 1 cut(s) 18
FokI GGATG 2 cut(s) 8, 268
FspBI CTAG 1 cut(s) 449
GsaI CCCAGC 2 cut(s) 292, 321
HaeIII GGCC 8 cut(s) 99, 128, 157, 186, 215, 244, 273, 389
HgaI GACGC 2 cut(s) 216, 245
HinfI GANTC 1 cut(s) 249
Hpy166II GTNNAC 2 cut(s) 111, 169
Hpy188I TCNGA 5 cut(s) 41, 359, 417, 446, 475
Hpy8I GTNNAC 2 cut(s) 111, 169
HpyF3I CTNAG 3 cut(s) 57, 298, 327
LweI GCATC 1 cut(s) 479
MaeI CTAG 1 cut(s) 449
MluCI AATT 1 cut(s) 494
MmeI TCCRAC 2 cut(s) 284, 498
MspR9I CCNGG 4 cut(s) 15, 67, 115, 173
MvaI CCWGG 4 cut(s) 15, 67, 115, 173
NmeAIII GCCGAG 8 cut(s) 75, 104, 133, 162, 191, 220, 249, 365
PfeI GAWTC 1 cut(s) 249
PfoI TCCNGGA 1 cut(s) 65
Psp6I CCWGG 4 cut(s) 13, 65, 113, 171
PspFI CCCAGC 2 cut(s) 288, 317
PspGI CCWGG 4 cut(s) 13, 65, 113, 171
ScrFI CCNGG 4 cut(s) 15, 67, 115, 173
SfaNI GCATC 1 cut(s) 479
Sse9I AATT 1 cut(s) 494
SsiI CCGC 7 cut(s) 11, 25, 82, 314, 372, 401, 459
SspMI CTAG 1 cut(s) 449
StyD4I CCNGG 4 cut(s) 13, 65, 113, 171
StyI CCWWGG 1 cut(s) 462
TasI AATT 1 cut(s) 494
TfiI GAWTC 1 cut(s) 249
TspDTI ATGAA 3 cut(s) 10, 39, 270
TspGWI ACGGA 2 cut(s) 129, 187
XapI RAATTY 1 cut(s) 494
XspI CTAG 1 cut(s) 449
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.