Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8241161.1

Orthogroup ID

OG0015533

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 455

Gene Structure 454 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8241161.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 454 bp

atgtgttgcattgccttaatctcaattcatatttctctggccaatgctgatccattagctgatgaattcgtcgaagcacacaacaaatatcgtgcagtggaaaatgttcctccggtttcatgggacgaaacagtcgcagaatatgctagaaattatgccaattcaaaagccgagacttgtgaaatggtgcattcacatggacaatatggtgaatgcttagccatgggtaattacgatgtttcaccttcaaaggcggtggagttgtgggcggatgagaaacaatattatgaccatgcctccaatacatgtgccgcaggccaggtgtgcggccactacactcaggtggtctgggaaaaatcaacccacattgggtgtgccaaggttcgttgccagaatggaggtacttttataacatgcaactatgatcctcctggtaactatgttggtgaaaaac

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04016 ko04075 ko04626 map04016 map04075 map04626

Pfam Domains

Protein Families

CAP

Protein Analysis

151

Amino Acids

16.67

Weight (kDa)

5.1

Isoelectric Point (pI)

35.79

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015533)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g07020
rosa_chinensis	RchiOBHm_Chr6g0247361 RchiOBHm_Chr6g0247381
rosa_laevigata	RLG00000015200
rosa_multiflora	Rmu_co8241161.1_g000001 Rmu_sc0000745.1_g000004 Rmu_sc0012746.1_g000020
rosa_roxburghii	Rroxscaffold_180G00433510 Rroxscaffold_7G00214000 Rroxscaffold_7G00214020
rosa_rugosa	Rorug05G0525500
rosa_samantha	Rh6BG035200 Rh6BG035400 Rh6CG034900
rosa_wichuraiana	Rw6G003470 Rw6G003480

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	410
AasI	GACNNNNNNGTC	1 cut(s)	131
AciI	CCGC	4 cut(s)	254, 269, 312, 327
AclWI	GGATC	2 cut(s)	44, 419
AcoI	YGGCCR	2 cut(s)	39, 328
AcsI	RAATTY	1 cut(s)	65
AfaI	GTAC	1 cut(s)	403
AfiI	CCNNNNNNNGG	1 cut(s)	369
AflIII	ACRYGT	1 cut(s)	305
AgsI	TTSAA	2 cut(s)	165, 249
AjnI	CCWGG	2 cut(s)	318, 430
AleI	CACNNNNGTG	1 cut(s)	341
AluBI	AGCT	1 cut(s)	59
AluI	AGCT	1 cut(s)	59
Alw26I	GTCTC	1 cut(s)	167
AlwI	GGATC	2 cut(s)	44, 419
AoxI	GGCC	3 cut(s)	39, 316, 328
ApoI	RAATTY	1 cut(s)	65
Asp700I	GAANNNNTTC	1 cut(s)	105
AsuHPI	GGTGA	2 cut(s)	221, 234
BalI	TGGCCA	1 cut(s)	41
BciT130I	CCWGG	2 cut(s)	320, 432
BcoDI	GTCTC	1 cut(s)	167
BfaI	CTAG	1 cut(s)	147
BisI	GCNGC	2 cut(s)	312, 328
BlpI	GCTNAGC	1 cut(s)	217
BlsI	GCNGC	2 cut(s)	313, 329
Bme1390I	CCNGG	2 cut(s)	320, 432
BmrFI	CCNGG	2 cut(s)	320, 432
Bpu1102I	GCTNAGC	1 cut(s)	217
BsaJI	CCNNGG	2 cut(s)	222, 378
BsaWI	WCCGGW	1 cut(s)	112
BsaXI	ACNNNNNCTCC	2 cut(s)	281, 311
Bsc4I	CCNNNNNNNGG	1 cut(s)	369
Bse3DI	GCAATG	1 cut(s)	9
BseBI	CCWGG	2 cut(s)	320, 432
BseDI	CCNNGG	2 cut(s)	222, 378
BseGI	GGATG	1 cut(s)	277
BseLI	CCNNNNNNNGG	1 cut(s)	369
BseMI	GCAATG	1 cut(s)	9
BseMII	CTCAG	1 cut(s)	353
BsgI	GTGCAG	1 cut(s)	114
BshFI	GGCC	3 cut(s)	41, 318, 330
BsiSI	CCGG	1 cut(s)	113
BslFI	GGGAC	1 cut(s)	137
BslI	CCNNNNNNNGG	1 cut(s)	369
BsmAI	GTCTC	1 cut(s)	167
BsmFI	GGGAC	1 cut(s)	137
BsmI	GAATGC	2 cut(s)	190, 218
BsnI	GGCC	3 cut(s)	41, 318, 330
Bsp143I	GATC	2 cut(s)	49, 424
Bsp1720I	GCTNAGC	1 cut(s)	217
Bsp19I	CCATGG	1 cut(s)	222
BspACI	CCGC	4 cut(s)	254, 269, 312, 327
BspANI	GGCC	3 cut(s)	41, 318, 330
BspCNI	CTCAG	1 cut(s)	352
BspPI	GGATC	2 cut(s)	44, 419
BsrDI	GCAATG	1 cut(s)	9
BssECI	CCNNGG	2 cut(s)	222, 378
BssMI	GATC	2 cut(s)	49, 424
BssT1I	CCWWGG	2 cut(s)	222, 378
Bst2UI	CCWGG	2 cut(s)	320, 432
Bst4CI	ACNGT	1 cut(s)	133
BstAPI	GCANNNNNTGC	1 cut(s)	143
BstC8I	GCNNGC	1 cut(s)	316
BstDEI	CTNAG	2 cut(s)	217, 339
BstDSI	CCRYGG	1 cut(s)	222
BstF5I	GGATG	1 cut(s)	277
BstKTI	GATC	2 cut(s)	52, 427
BstMAI	GTCTC	1 cut(s)	167
BstMBI	GATC	2 cut(s)	49, 424
BstMWI	GCNNNNNNNGC	2 cut(s)	143, 324
BstNI	CCWGG	2 cut(s)	320, 432
BstNSI	RCATGY	2 cut(s)	309, 417
BstSCI	CCNGG	2 cut(s)	318, 430
BsuRI	GGCC	3 cut(s)	41, 318, 330
BtgI	CCRYGG	1 cut(s)	222
BtsCI	GGATG	1 cut(s)	277
BtsI	GCAGTG	1 cut(s)	102
BtsIMutI	CAGTG	1 cut(s)	102
Cac8I	GCNNGC	1 cut(s)	316
Csp6I	GTAC	1 cut(s)	402
CspCI	CAANNNNNGTGG	2 cut(s)	237, 272
CviAII	CATG	6 cut(s)	120, 197, 223, 293, 306, 414
CviJI	RGCY	6 cut(s)	41, 59, 170, 221, 318, 330
CviKI_1	RGCY	6 cut(s)	41, 59, 170, 221, 318, 330
CviQI	GTAC	1 cut(s)	402
DdeI	CTNAG	2 cut(s)	217, 339
DpnI	GATC	2 cut(s)	51, 426
DpnII	GATC	2 cut(s)	49, 424
DrdI	GACNNNNNNGTC	1 cut(s)	131
DseDI	GACNNNNNNGTC	1 cut(s)	131
EaeI	YGGCCR	2 cut(s)	39, 328
EciI	GGCGGA	1 cut(s)	284
Eco130I	CCWWGG	2 cut(s)	222, 378
EcoRI	GAATTC	1 cut(s)	65
EcoRII	CCWGG	2 cut(s)	318, 430
EcoT14I	CCWWGG	2 cut(s)	222, 378
ErhI	CCWWGG	2 cut(s)	222, 378
FaeI	CATG	6 cut(s)	123, 200, 226, 296, 309, 417
FaqI	GGGAC	1 cut(s)	137
FatI	CATG	6 cut(s)	119, 196, 222, 292, 305, 413
Fnu4HI	GCNGC	2 cut(s)	312, 328
FokI	GGATG	1 cut(s)	284
Fsp4HI	GCNGC	2 cut(s)	312, 328
FspBI	CTAG	1 cut(s)	147
GluI	GCNGC	2 cut(s)	312, 328
HaeIII	GGCC	3 cut(s)	41, 318, 330
HapII	CCGG	1 cut(s)	113
Hin1II	CATG	6 cut(s)	123, 200, 226, 296, 309, 417
HpaII	CCGG	1 cut(s)	113
HphI	GGTGA	2 cut(s)	221, 234
Hpy99I	CGWCG	1 cut(s)	74
HpyAV	CCTTC	1 cut(s)	255
HpyCH4III	ACNGT	1 cut(s)	133
HpyCH4V	TGCA	4 cut(s)	9, 95, 190, 417
HpyF10VI	GCNNNNNNNGC	2 cut(s)	143, 324
HpyF3I	CTNAG	2 cut(s)	217, 339
Hsp92II	CATG	6 cut(s)	123, 200, 226, 296, 309, 417
Kzo9I	GATC	2 cut(s)	49, 424
MaeI	CTAG	1 cut(s)	147
MaeIII	GTNAC	1 cut(s)	434
MalI	GATC	2 cut(s)	51, 426
MboI	GATC	2 cut(s)	49, 424
MlsI	TGGCCA	1 cut(s)	41
MluCI	AATT	5 cut(s)	24, 65, 151, 160, 229
MluNI	TGGCCA	1 cut(s)	41
MnlI	CCTC	4 cut(s)	120, 307, 392, 438
Mox20I	TGGCCA	1 cut(s)	41
MroXI	GAANNNNTTC	1 cut(s)	105
MscI	TGGCCA	1 cut(s)	41
MseI	TTAA	1 cut(s)	17
MslI	CAYNNNNRTG	2 cut(s)	195, 341
Msp20I	TGGCCA	1 cut(s)	41
MspI	CCGG	1 cut(s)	113
MspR9I	CCNGG	2 cut(s)	320, 432
Mva1269I	GAATGC	2 cut(s)	190, 218
MvaI	CCWGG	2 cut(s)	320, 432
MwoI	GCNNNNNNNGC	2 cut(s)	143, 324
NcoI	CCATGG	1 cut(s)	222
NdeII	GATC	2 cut(s)	49, 424
NlaIII	CATG	6 cut(s)	123, 200, 226, 296, 309, 417
NmeAIII	GCCGAG	1 cut(s)	196
NspI	RCATGY	2 cut(s)	309, 417
OliI	CACNNNNGTG	1 cut(s)	341
PciI	ACATGT	1 cut(s)	305
PctI	GAATGC	2 cut(s)	190, 218
PdmI	GAANNNNTTC	1 cut(s)	105
PkrI	GCNGC	2 cut(s)	313, 329
PscI	ACATGT	1 cut(s)	305
PsiI	TTATAA	1 cut(s)	410
Psp6I	CCWGG	2 cut(s)	318, 430
PspGI	CCWGG	2 cut(s)	318, 430
RsaI	GTAC	1 cut(s)	403
RsaNI	GTAC	1 cut(s)	402
RseI	CAYNNNNRTG	2 cut(s)	195, 341
SaqAI	TTAA	1 cut(s)	17
SatI	GCNGC	2 cut(s)	312, 328
Sau3AI	GATC	2 cut(s)	49, 424
ScrFI	CCNGG	2 cut(s)	320, 432
SetI	ASST	6 cut(s)	61, 247, 324, 345, 384, 403
SmiMI	CAYNNNNRTG	2 cut(s)	195, 341
Sse9I	AATT	5 cut(s)	24, 65, 151, 160, 229
SsiI	CCGC	4 cut(s)	254, 269, 312, 327
SspI	AATATT	1 cut(s)	284
SspMI	CTAG	1 cut(s)	147
StyD4I	CCNGG	2 cut(s)	318, 430
StyI	CCWWGG	2 cut(s)	222, 378
TaaI	ACNGT	1 cut(s)	133
TaqI	TCGA	1 cut(s)	72
TasI	AATT	5 cut(s)	24, 65, 151, 160, 229
TauI	GCSGC	2 cut(s)	314, 330
Tru1I	TTAA	1 cut(s)	17
Tru9I	TTAA	1 cut(s)	17
TscAI	CASTG	1 cut(s)	102
TspDTI	ATGAA	3 cut(s)	17, 78, 108
TspRI	CASTG	1 cut(s)	102
XapI	RAATTY	1 cut(s)	65
XceI	RCATGY	2 cut(s)	309, 417
XmnI	GAANNNNTTC	1 cut(s)	105
XspI	CTAG	1 cut(s)	147

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.