Rmu_co8258861.1_g000001

L-ascorbate oxidase homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8258861.1
Physical Location & Seq
Reverse (-)
1 .. 392
392 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8258861.1_g000001.1.cds

Sequence Viewer

Length: 248 bp
atgggttttacgtggcatttcggtgccgtcgttctggttctggctcttgtcacacttgtgaatggtgaagacccttacaggttcttcgagtggaatgtgacctacggtgacatttaccctctcggcgttaagcaacggggtattcttataaatggacagtttccggggccggaaatctactccgtcaccaatgacaacctcattatcaacgtttacaacagcttgccggagcctttccttattacatg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.28

Weight (kDa)

4.43

Isoelectric Point (pI)

16.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 149
AccB1I GGYRCC 1 cut(s) 23
AclI AACGTT 1 cut(s) 210
AleI CACNNNNGTG 1 cut(s) 56
AluBI AGCT 1 cut(s) 222
AluI AGCT 1 cut(s) 222
AoxI GGCC 1 cut(s) 167
AspS9I GGNCC 1 cut(s) 167
AsuC2I CCSGG 1 cut(s) 165
AsuHPI GGTGA 3 cut(s) 77, 119, 178
BanI GGYRCC 1 cut(s) 23
BbsI GAAGAC 1 cut(s) 75
BceAI ACGGC 1 cut(s) 11
BcnI CCSGG 1 cut(s) 165
Bme1390I CCNGG 1 cut(s) 165
BmgT120I GGNCC 1 cut(s) 167
BmiI GGNNCC 3 cut(s) 25, 168, 231
BmrFI CCNGG 1 cut(s) 165
BpiI GAAGAC 1 cut(s) 75
BpuMI CCSGG 1 cut(s) 165
BsaAI YACGTR 1 cut(s) 12
BsaJI CCNNGG 1 cut(s) 164
BseDI CCNNGG 1 cut(s) 164
BshFI GGCC 1 cut(s) 169
BshNI GGYRCC 1 cut(s) 23
BsiSI CCGG 3 cut(s) 164, 170, 227
BsnI GGCC 1 cut(s) 169
BspANI GGCC 1 cut(s) 169
BspLI GGNNCC 3 cut(s) 25, 168, 231
BspT107I GGYRCC 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 164
Bst4CI ACNGT 2 cut(s) 107, 159
BstBAI YACGTR 1 cut(s) 12
BstC8I GCNNGC 1 cut(s) 224
BstSCI CCNGG 1 cut(s) 163
BstV2I GAAGAC 1 cut(s) 75
BsuRI GGCC 1 cut(s) 169
Cac8I GCNNGC 1 cut(s) 224
Cfr13I GGNCC 1 cut(s) 167
CviAII CATG 1 cut(s) 246
CviJI RGCY 4 cut(s) 44, 169, 222, 232
CviKI_1 RGCY 4 cut(s) 44, 169, 222, 232
FaiI YATR 2 cut(s) 149, 247
HaeIII GGCC 1 cut(s) 169
HapII CCGG 3 cut(s) 164, 170, 227
HpaII CCGG 3 cut(s) 164, 170, 227
HphI GGTGA 3 cut(s) 77, 119, 178
Hpy166II GTNNAC 1 cut(s) 214
Hpy8I GTNNAC 1 cut(s) 214
Hpy99I CGWCG 1 cut(s) 32
HpyCH4III ACNGT 2 cut(s) 107, 159
HpyCH4IV ACGT 2 cut(s) 11, 210
HpySE526I ACGT 2 cut(s) 11, 210
LmnI GCTCC 1 cut(s) 229
LpnPI CCDG 6 cut(s) 20, 26, 64, 177, 183, 240
MaeII ACGT 2 cut(s) 11, 210
MaeIII GTNAC 4 cut(s) 49, 97, 107, 184
MboII GAAGA 2 cut(s) 76, 80
MnlI CCTC 2 cut(s) 129, 209
MseI TTAA 1 cut(s) 129
MslI CAYNNNNRTG 2 cut(s) 21, 56
MspI CCGG 3 cut(s) 164, 170, 227
MspR9I CCNGG 1 cut(s) 165
NciI CCSGG 1 cut(s) 165
NlaIV GGNNCC 3 cut(s) 25, 168, 231
NmeAIII GCCGAG 1 cut(s) 102
NmuCI GTSAC 4 cut(s) 49, 97, 107, 184
OliI CACNNNNGTG 1 cut(s) 56
PcsI WCGNNNNNNNCGW 1 cut(s) 27
Ppu21I YACGTR 1 cut(s) 12
PsiI TTATAA 1 cut(s) 149
Psp1406I AACGTT 1 cut(s) 210
PspN4I GGNNCC 3 cut(s) 25, 168, 231
PspPI GGNCC 1 cut(s) 167
RseI CAYNNNNRTG 2 cut(s) 21, 56
SaqAI TTAA 1 cut(s) 129
Sau96I GGNCC 1 cut(s) 167
ScrFI CCNGG 1 cut(s) 165
SetI ASST 6 cut(s) 14, 83, 104, 201, 213, 224
SmiMI CAYNNNNRTG 2 cut(s) 21, 56
StyD4I CCNGG 1 cut(s) 163
TaaI ACNGT 2 cut(s) 107, 159
TaiI ACGT 2 cut(s) 14, 213
TaqI TCGA 1 cut(s) 87
Tru1I TTAA 1 cut(s) 129
Tru9I TTAA 1 cut(s) 129
TseFI GTSAC 4 cut(s) 49, 97, 107, 184
Tsp45I GTSAC 4 cut(s) 49, 97, 107, 184
TspGWI ACGGA 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.