Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0040022.1

Orthogroup ID

OG0009783

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 330

Gene Structure 329 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0040022.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 235 bp

atgggaaaagcagtcttgctccaattgctgcttggtgctttggctgttgtgttaagcgcttctgtggtgaaagcagaggacccatataagtactacacctggactgtgacttatgggactctctctcctctgggtgttccccaacaggtgatacttatcaatggtcaatttcctgggcctagacttgatgtggtgaccaatgacaacatcatcctcaacctcattaacaagttgg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cu-oxidase Cu-oxidase_2 Cu-oxidase_3

Protein Analysis

78

Amino Acids

8.45

Weight (kDa)

8.03

Isoelectric Point (pI)

27.54

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009783)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G28090 AT4G38420 AT4G38420 AT4G38420
fragaria_vesca	FvH4_2g16000
malus_domestica	MD05G1128800.v1.1 MD10G1132000.v1.1
prunus_persica	Prupe.8G172900_v2.0.a1
pyrus_communis	pycom05g12480 pycom10g11310
rosa_chinensis	RchiOBHm_Chr6g0279531
rosa_laevigata	RLG00000013138
rosa_multiflora	Rmu_co8258861.1_g000001 Rmu_sc0004644.1_g000011 Rmu_sc0004649.1_g000018 Rmu_sc0040022.1_g000001
rosa_roxburghii	Rroxscaffold_7G00188830
rosa_rugosa	Rorug06G0125300
rosa_samantha	Rh6BG238700 Rh6DG232200
rosa_wichuraiana	Rw6G020450

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	92
AfeI	AGCGCT	1 cut(s)	58
AjnI	CCWGG	2 cut(s)	98, 172
Aor51HI	AGCGCT	1 cut(s)	58
AoxI	GGCC	1 cut(s)	176
ApeKI	GCWGC	1 cut(s)	28
AspLEI	GCGC	1 cut(s)	59
AspS9I	GGNCC	2 cut(s)	79, 176
AsuHPI	GGTGA	3 cut(s)	79, 160, 205
AvaII	GGWCC	1 cut(s)	79
BbvI	GCAGC	1 cut(s)	15
BciT130I	CCWGG	2 cut(s)	100, 174
BfaI	CTAG	1 cut(s)	180
BfoI	RGCGCY	1 cut(s)	60
BisI	GCNGC	1 cut(s)	29
BlsI	GCNGC	1 cut(s)	30
BmcAI	AGTACT	1 cut(s)	92
Bme1390I	CCNGG	2 cut(s)	100, 174
Bme18I	GGWCC	1 cut(s)	79
BmgT120I	GGNCC	2 cut(s)	79, 176
BmiI	GGNNCC	1 cut(s)	81
BmrFI	CCNGG	2 cut(s)	100, 174
BsaBI	GATNNNNATC	1 cut(s)	155
BsaJI	CCNNGG	1 cut(s)	173
BsaXI	ACNNNNNCTCC	2 cut(s)	109, 139
Bse8I	GATNNNNATC	1 cut(s)	155
BseBI	CCWGG	2 cut(s)	100, 174
BseDI	CCNNGG	1 cut(s)	173
BseGI	GGATG	1 cut(s)	210
BseJI	GATNNNNATC	1 cut(s)	155
BseRI	GAGGAG	1 cut(s)	117
BseXI	GCAGC	1 cut(s)	15
BshFI	GGCC	1 cut(s)	178
BslFI	GGGAC	1 cut(s)	130
BsmFI	GGGAC	1 cut(s)	130
BsnI	GGCC	1 cut(s)	178
BspANI	GGCC	1 cut(s)	178
BspLI	GGNNCC	1 cut(s)	81
BssECI	CCNNGG	1 cut(s)	173
Bst2UI	CCWGG	2 cut(s)	100, 174
Bst4CI	ACNGT	1 cut(s)	106
BstEII	GGTNACC	1 cut(s)	193
BstF5I	GGATG	1 cut(s)	210
BstH2I	RGCGCY	1 cut(s)	60
BstHHI	GCGC	1 cut(s)	59
BstMWI	GCNNNNNNNGC	1 cut(s)	25
BstNI	CCWGG	2 cut(s)	100, 174
BstPI	GGTNACC	1 cut(s)	193
BstSCI	CCNGG	2 cut(s)	98, 172
BstV1I	GCAGC	1 cut(s)	15
BsuRI	GGCC	1 cut(s)	178
BtsCI	GGATG	1 cut(s)	210
CfoI	GCGC	1 cut(s)	59
Cfr13I	GGNCC	2 cut(s)	79, 176
Csp6I	GTAC	1 cut(s)	91
CviJI	RGCY	2 cut(s)	44, 178
CviKI_1	RGCY	2 cut(s)	44, 178
CviQI	GTAC	1 cut(s)	91
Eco47I	GGWCC	1 cut(s)	79
Eco47III	AGCGCT	1 cut(s)	58
Eco91I	GGTNACC	1 cut(s)	193
EcoO109I	RGGNCCY	1 cut(s)	79
EcoO65I	GGTNACC	1 cut(s)	193
EcoRII	CCWGG	2 cut(s)	98, 172
FaiI	YATR	3 cut(s)	85, 87, 114
FaqI	GGGAC	1 cut(s)	130
Fnu4HI	GCNGC	1 cut(s)	29
FokI	GGATG	1 cut(s)	197
Fsp4HI	GCNGC	1 cut(s)	29
FspBI	CTAG	1 cut(s)	180
GlaI	GCGC	1 cut(s)	58
GluI	GCNGC	1 cut(s)	29
HaeII	RGCGCY	1 cut(s)	60
HaeIII	GGCC	1 cut(s)	178
HhaI	GCGC	1 cut(s)	59
Hin6I	GCGC	1 cut(s)	57
HinP1I	GCGC	1 cut(s)	57
HinfI	GANTC	1 cut(s)	118
HphI	GGTGA	3 cut(s)	79, 160, 205
HpyCH4III	ACNGT	1 cut(s)	106
HpyF10VI	GCNNNNNNNGC	1 cut(s)	25
HspAI	GCGC	1 cut(s)	57
LmnI	GCTCC	1 cut(s)	24
LpnPI	CCDG	6 cut(s)	85, 112, 116, 131, 159, 186
Lsp1109I	GCAGC	1 cut(s)	15
MaeI	CTAG	1 cut(s)	180
MaeIII	GTNAC	2 cut(s)	106, 193
MfeI	CAATTG	1 cut(s)	23
MluCI	AATT	2 cut(s)	23, 167
MlyI	GAGTC	1 cut(s)	112
MnlI	CCTC	4 cut(s)	70, 138, 224, 230
MseI	TTAA	2 cut(s)	53, 225
MspR9I	CCNGG	2 cut(s)	100, 174
MunI	CAATTG	1 cut(s)	23
MvaI	CCWGG	2 cut(s)	100, 174
MwoI	GCNNNNNNNGC	1 cut(s)	25
NlaIV	GGNNCC	1 cut(s)	81
NmuCI	GTSAC	2 cut(s)	106, 193
PkrI	GCNGC	1 cut(s)	30
PleI	GAGTC	1 cut(s)	112
PpsI	GAGTC	1 cut(s)	112
PpuMI	RGGWCCY	1 cut(s)	79
Psp5II	RGGWCCY	1 cut(s)	79
Psp6I	CCWGG	2 cut(s)	98, 172
PspEI	GGTNACC	1 cut(s)	193
PspGI	CCWGG	2 cut(s)	98, 172
PspN4I	GGNNCC	1 cut(s)	81
PspPI	GGNCC	2 cut(s)	79, 176
PspPPI	RGGWCCY	1 cut(s)	79
RsaI	GTAC	1 cut(s)	92
RsaNI	GTAC	1 cut(s)	91
SaqAI	TTAA	2 cut(s)	53, 225
SatI	GCNGC	1 cut(s)	29
Sau96I	GGNCC	2 cut(s)	79, 176
ScaI	AGTACT	1 cut(s)	92
SchI	GAGTC	1 cut(s)	112
ScrFI	CCNGG	2 cut(s)	100, 174
SetI	ASST	3 cut(s)	101, 150, 222
SinI	GGWCC	1 cut(s)	79
Sse9I	AATT	2 cut(s)	23, 167
SspMI	CTAG	1 cut(s)	180
StyD4I	CCNGG	2 cut(s)	98, 172
TaaI	ACNGT	1 cut(s)	106
TasI	AATT	2 cut(s)	23, 167
TatI	WGTACW	1 cut(s)	90
Tru1I	TTAA	2 cut(s)	53, 225
Tru9I	TTAA	2 cut(s)	53, 225
TseFI	GTSAC	2 cut(s)	106, 193
TseI	GCWGC	1 cut(s)	28
Tsp45I	GTSAC	2 cut(s)	106, 193
VpaK11BI	GGWCC	1 cut(s)	79
XcmI	CCANNNNNNNNNTGG	1 cut(s)	29
XspI	CTAG	1 cut(s)	180
ZrmI	AGTACT	1 cut(s)	92

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.