Rmu_co8262551.1_g000001

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8262551.1
Physical Location & Seq
Reverse (-)
2 .. 801
800 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8262551.1_g000001.1.cds

Sequence Viewer

Length: 365 bp
atgccgaacaagctagttgatgcctcacttatctgttgtgtttttgatgaagaagctaccaaaccagatatctttcacggttttgatgaagaagatgcctacccatatattagctgtgctgagggtgtgctgaagaaggtgtcctcacttgtcaatgagcaaatcagtcttgcatgggggttcaaagaagatctgaagaagctaggcgagtcgttatcactaatccagaacatgttgaatgatgcggcggagaaaccacaagccctaaatcgaggtaagacagtggaagggtgggtgaagaaactcaaaggcatagctgatgatgcagacaatgtgctggatgaatgcaactatgaagttttccg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

13.63

Weight (kDa)

4.55

Isoelectric Point (pI)

22.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019829)

Species Orthologous Gene IDs
pyrus_communis pycom14g06190
rosa_multiflora Rmu_co8262551.1_g000001 Rmu_sc0008322.1_g000019
rosa_roxburghii Rroxscaffold_2G00152090
rosa_rugosa Rorug01G0488700
rosa_samantha Rh2AG044800 Rh3BG279700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 245, 248
AcuI CTGAAG 2 cut(s) 152, 215
AflIII ACRYGT 1 cut(s) 231
AgsI TTSAA 2 cut(s) 184, 238
AluBI AGCT 5 cut(s) 13, 56, 114, 202, 317
AluI AGCT 5 cut(s) 13, 56, 114, 202, 317
AsuHPI GGTGA 1 cut(s) 307
BbvCI CCTCAGC 1 cut(s) 120
BfaI CTAG 2 cut(s) 14, 203
BglII AGATCT 1 cut(s) 190
BisI GCNGC 1 cut(s) 246
BlsI GCNGC 1 cut(s) 247
BmsI GCATC 4 cut(s) 10, 85, 232, 313
Bpu10I CCTNAGC 1 cut(s) 120
BseGI GGATG 1 cut(s) 346
BseMII CTCAG 1 cut(s) 111
BsmI GAATGC 1 cut(s) 350
Bsp143I GATC 1 cut(s) 190
BspACI CCGC 2 cut(s) 245, 248
BspCNI CTCAG 1 cut(s) 112
BssMI GATC 1 cut(s) 190
Bst4CI ACNGT 2 cut(s) 80, 283
BstDEI CTNAG 1 cut(s) 120
BstF5I GGATG 1 cut(s) 346
BstKTI GATC 1 cut(s) 193
BstMBI GATC 1 cut(s) 190
BstMWI GCNNNNNNNGC 2 cut(s) 10, 323
BstNSI RCATGY 1 cut(s) 235
BstX2I RGATCY 1 cut(s) 190
BstYI RGATCY 1 cut(s) 190
BtsCI GGATG 1 cut(s) 346
BtsIMutI CAGTG 1 cut(s) 288
CviAII CATG 2 cut(s) 174, 232
CviJI RGCY 6 cut(s) 13, 56, 114, 202, 263, 317
CviKI_1 RGCY 6 cut(s) 13, 56, 114, 202, 263, 317
DdeI CTNAG 1 cut(s) 120
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
EciI GGCGGA 1 cut(s) 263
Eco32I GATATC 1 cut(s) 70
Eco57I CTGAAG 2 cut(s) 152, 215
EcoRV GATATC 1 cut(s) 70
FaeI CATG 2 cut(s) 177, 235
FaiI YATR 6 cut(s) 106, 108, 175, 233, 314, 354
FatI CATG 2 cut(s) 173, 231
Fnu4HI GCNGC 1 cut(s) 246
FokI GGATG 1 cut(s) 353
Fsp4HI GCNGC 1 cut(s) 246
FspBI CTAG 2 cut(s) 14, 203
GluI GCNGC 1 cut(s) 246
Hin1II CATG 2 cut(s) 177, 235
HinfI GANTC 1 cut(s) 209
HphI GGTGA 1 cut(s) 307
Hpy188I TCNGA 1 cut(s) 195
Hpy188III TCNNGA 1 cut(s) 226
HpyAV CCTTC 2 cut(s) 130, 281
HpyCH4III ACNGT 2 cut(s) 80, 283
HpyCH4V TGCA 3 cut(s) 173, 326, 348
HpyF10VI GCNNNNNNNGC 2 cut(s) 10, 323
HpyF3I CTNAG 1 cut(s) 120
Hsp92II CATG 2 cut(s) 177, 235
Kzo9I GATC 1 cut(s) 190
LpnPI CCDG 3 cut(s) 78, 239, 323
LweI GCATC 4 cut(s) 10, 85, 232, 313
MaeI CTAG 2 cut(s) 14, 203
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 7 cut(s) 62, 101, 104, 145, 200, 208, 310
MflI RGATCY 1 cut(s) 190
MlyI GAGTC 1 cut(s) 218
MnlI CCTC 4 cut(s) 34, 115, 154, 266
Mva1269I GAATGC 1 cut(s) 350
MwoI GCNNNNNNNGC 2 cut(s) 10, 323
NdeII GATC 1 cut(s) 190
NlaIII CATG 2 cut(s) 177, 235
NspI RCATGY 1 cut(s) 235
PciI ACATGT 1 cut(s) 231
PctI GAATGC 1 cut(s) 350
PkrI GCNGC 1 cut(s) 247
PleI GAGTC 1 cut(s) 217
PpsI GAGTC 1 cut(s) 217
PscI ACATGT 1 cut(s) 231
PsuI RGATCY 1 cut(s) 190
SatI GCNGC 1 cut(s) 246
Sau3AI GATC 1 cut(s) 190
SchI GAGTC 1 cut(s) 218
SetI ASST 7 cut(s) 15, 58, 116, 141, 204, 277, 319
SfaNI GCATC 4 cut(s) 10, 85, 232, 313
SsiI CCGC 2 cut(s) 245, 248
SspMI CTAG 2 cut(s) 14, 203
TaaI ACNGT 2 cut(s) 80, 283
TaqI TCGA 1 cut(s) 271
TauI GCSGC 1 cut(s) 248
TscAI CASTG 1 cut(s) 288
TspDTI ATGAA 3 cut(s) 63, 102, 357
TspRI CASTG 1 cut(s) 288
XceI RCATGY 1 cut(s) 235
XspI CTAG 2 cut(s) 14, 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.