Rh3BG279700

Belongs to the disease resistance NB-LRR family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0019829
Physical Location & Seq
Forward (+)
27605463 .. 27613082
7620 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG279700.1

Sequence Viewer

Length: 393 bp
ATGGTTGAACTTGTGTATGATTTGGCCAGCAGACTAACTGAGAAGCTTGGCTCACTTGCTTACAATGAGATTTACTCTTCCTGGGGAGTTGAAACCGATCTTCAAAAGCTTGAGGACACCATGTCCACCATCAAAGTTGTGCTCTTGATGCTGAAGAGAAGCAGGCTCATAACTAGGAGATTTGCAGTTGGCTACTCATGCTTAAAGATTTGTTTCGTGACGCTGAAGATGTGTTGGATGAGTTTGAGTGCGAAGCTTTGCAAAGGCAGGTTCACGGCAAAAGTACGTAGAAAGCAAACAGCTGGAATTGGGGAAGGAAAACTATCAAGATATGGAATTAACGCTCCAAAAATTGGTTATTGTAGGTGCACCAAAGATGGTGGCATTGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04014 map04014
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

130

Amino Acids

14.62

Weight (kDa)

9.75

Isoelectric Point (pI)

44.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rx_N PF18052 10 - 53 1.4e-06 Rx N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019829)

Species Orthologous Gene IDs
pyrus_communis pycom14g06190
rosa_multiflora Rmu_co8262551.1_g000001 Rmu_sc0008322.1_g000019
rosa_roxburghii Rroxscaffold_2G00152090
rosa_rugosa Rorug01G0488700
rosa_samantha Rh2AG044800 Rh3BG279700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 258
AccB7I CCANNNNNTGG 1 cut(s) 353
AcoI YGGCCR 1 cut(s) 24
AcuI CTGAAG 2 cut(s) 173, 245
AfaI GTAC 1 cut(s) 285
AfiI CCNNNNNNNGG 1 cut(s) 353
AgsI TTSAA 3 cut(s) 8, 92, 104
AhdI GACNNNNNGTC 1 cut(s) 121
AjnI CCWGG 1 cut(s) 80
AluBI AGCT 4 cut(s) 46, 109, 256, 302
AluI AGCT 4 cut(s) 46, 109, 256, 302
Alw21I GWGCWC 2 cut(s) 144, 371
Alw44I GTGCAC 1 cut(s) 367
AoxI GGCC 1 cut(s) 24
ApaLI GTGCAC 1 cut(s) 367
BaeGI GKGCMC 1 cut(s) 371
BalI TGGCCA 1 cut(s) 26
Bbv12I GWGCWC 2 cut(s) 144, 371
BccI CCATC 2 cut(s) 137, 371
BceAI ACGGC 1 cut(s) 291
BciT130I CCWGG 1 cut(s) 82
BfaI CTAG 1 cut(s) 174
BfuAI ACCTGC 1 cut(s) 258
Bme1390I CCNGG 1 cut(s) 82
BmeRI GACNNNNNGTC 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 82
BmsI GCATC 1 cut(s) 138
BplI GAGNNNNNCTC 2 cut(s) 59, 91
BpuEI CTTGAG 1 cut(s) 131
BsaAI YACGTR 1 cut(s) 287
BsaJI CCNNGG 1 cut(s) 81
Bsc4I CCNNNNNNNGG 1 cut(s) 353
Bse3DI GCAATG 1 cut(s) 384
BseBI CCWGG 1 cut(s) 82
BseDI CCNNGG 1 cut(s) 81
BseGI GGATG 1 cut(s) 243
BseLI CCNNNNNNNGG 1 cut(s) 353
BseMI GCAATG 1 cut(s) 384
BseMII CTCAG 1 cut(s) 30
BseSI GKGCMC 1 cut(s) 371
BshFI GGCC 1 cut(s) 26
BsiHKAI GWGCWC 2 cut(s) 144, 371
BslI CCNNNNNNNGG 1 cut(s) 353
BsnI GGCC 1 cut(s) 26
Bsp1286I GDGCHC 2 cut(s) 144, 371
Bsp143I GATC 1 cut(s) 97
BspANI GGCC 1 cut(s) 26
BspCNI CTCAG 1 cut(s) 31
BspMI ACCTGC 1 cut(s) 258
BsrDI GCAATG 1 cut(s) 384
BssECI CCNNGG 1 cut(s) 81
BssMI GATC 1 cut(s) 97
Bst2UI CCWGG 1 cut(s) 82
Bst6I CTCTTC 2 cut(s) 82, 149
BstBAI YACGTR 1 cut(s) 287
BstC8I GCNNGC 2 cut(s) 28, 164
BstDEI CTNAG 1 cut(s) 39
BstF5I GGATG 1 cut(s) 243
BstKTI GATC 1 cut(s) 100
BstMBI GATC 1 cut(s) 97
BstMWI GCNNNNNNNGC 2 cut(s) 148, 198
BstNI CCWGG 1 cut(s) 82
BstSCI CCNGG 1 cut(s) 80
BstSLI GKGCMC 1 cut(s) 371
BstSNI TACGTA 1 cut(s) 287
BsuRI GGCC 1 cut(s) 26
BtsCI GGATG 1 cut(s) 243
BveI ACCTGC 1 cut(s) 258
Cac8I GCNNGC 2 cut(s) 28, 164
CseI GACGC 1 cut(s) 229
Csp6I GTAC 1 cut(s) 284
CspCI CAANNNNNGTGG 1 cut(s) 361
CviAII CATG 2 cut(s) 121, 198
CviJI RGCY 8 cut(s) 26, 46, 51, 109, 166, 192, 256, 302
CviKI_1 RGCY 8 cut(s) 26, 46, 51, 109, 166, 192, 256, 302
CviQI GTAC 1 cut(s) 284
DdeI CTNAG 1 cut(s) 39
DpnI GATC 1 cut(s) 99
DpnII GATC 1 cut(s) 97
DriI GACNNNNNGTC 1 cut(s) 121
EaeI YGGCCR 1 cut(s) 24
Eam1104I CTCTTC 2 cut(s) 82, 149
Eam1105I GACNNNNNGTC 1 cut(s) 121
EarI CTCTTC 2 cut(s) 82, 149
Eco105I TACGTA 1 cut(s) 287
Eco57I CTGAAG 2 cut(s) 173, 245
EcoRII CCWGG 1 cut(s) 80
FaeI CATG 2 cut(s) 124, 201
FaiI YATR 5 cut(s) 18, 122, 170, 199, 333
FatI CATG 2 cut(s) 120, 197
FokI GGATG 1 cut(s) 250
FspBI CTAG 1 cut(s) 174
HaeIII GGCC 1 cut(s) 26
HgaI GACGC 1 cut(s) 229
Hin1II CATG 2 cut(s) 124, 201
HindIII AAGCTT 3 cut(s) 44, 107, 254
Hpy166II GTNNAC 3 cut(s) 126, 273, 369
Hpy188III TCNNGA 3 cut(s) 145, 217, 327
Hpy8I GTNNAC 3 cut(s) 126, 273, 369
HpyAV CCTTC 1 cut(s) 308
HpyCH4IV ACGT 1 cut(s) 286
HpyCH4V TGCA 3 cut(s) 185, 261, 369
HpyF10VI GCNNNNNNNGC 2 cut(s) 148, 198
HpyF3I CTNAG 1 cut(s) 39
HpySE526I ACGT 1 cut(s) 286
Hsp92II CATG 2 cut(s) 124, 201
Kzo9I GATC 1 cut(s) 97
LmnI GCTCC 1 cut(s) 349
LpnPI CCDG 6 cut(s) 40, 67, 94, 148, 253, 288
LweI GCATC 1 cut(s) 138
MaeI CTAG 1 cut(s) 174
MaeII ACGT 1 cut(s) 286
MaeIII GTNAC 1 cut(s) 217
MalI GATC 1 cut(s) 99
MboI GATC 1 cut(s) 97
MboII GAAGA 4 cut(s) 69, 92, 166, 238
MhlI GDGCHC 2 cut(s) 144, 371
MlsI TGGCCA 1 cut(s) 26
MluCI AATT 3 cut(s) 306, 336, 351
MluNI TGGCCA 1 cut(s) 26
MmeI TCCRAC 1 cut(s) 215
MnlI CCTC 1 cut(s) 106
Mox20I TGGCCA 1 cut(s) 26
MscI TGGCCA 1 cut(s) 26
MseI TTAA 2 cut(s) 203, 339
Msp20I TGGCCA 1 cut(s) 26
MspA1I CMGCKG 1 cut(s) 302
MspR9I CCNGG 1 cut(s) 82
MvaI CCWGG 1 cut(s) 82
MwoI GCNNNNNNNGC 2 cut(s) 148, 198
NdeII GATC 1 cut(s) 97
NlaIII CATG 2 cut(s) 124, 201
NmuCI GTSAC 1 cut(s) 217
PflMI CCANNNNNTGG 1 cut(s) 353
Ppu21I YACGTR 1 cut(s) 287
Psp6I CCWGG 1 cut(s) 80
PspGI CCWGG 1 cut(s) 80
PvuII CAGCTG 1 cut(s) 302
RsaI GTAC 1 cut(s) 285
RsaNI GTAC 1 cut(s) 284
SaqAI TTAA 2 cut(s) 203, 339
Sau3AI GATC 1 cut(s) 97
ScrFI CCNGG 1 cut(s) 82
SduI GDGCHC 2 cut(s) 144, 371
SetI ASST 7 cut(s) 48, 111, 258, 272, 289, 304, 368
SfaNI GCATC 1 cut(s) 138
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
SnaBI TACGTA 1 cut(s) 287
Sse9I AATT 3 cut(s) 306, 336, 351
SspMI CTAG 1 cut(s) 174
StyD4I CCNGG 1 cut(s) 80
TaiI ACGT 1 cut(s) 289
TasI AATT 3 cut(s) 306, 336, 351
Tru1I TTAA 2 cut(s) 203, 339
Tru9I TTAA 2 cut(s) 203, 339
TseFI GTSAC 1 cut(s) 217
Tsp45I GTSAC 1 cut(s) 217
Van91I CCANNNNNTGG 1 cut(s) 353
VneI GTGCAC 1 cut(s) 367
XspI CTAG 1 cut(s) 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.