Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8273435.1

Orthogroup ID

OG0012148

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 833

Gene Structure 833 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8273435.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 671 bp

tcttcaaagcttgcaaagattgagaagagtgaagatggagacactttgctgcaacttgtggatggtactcagctatctgctaagattgtaattggctgtgatggaattcggtctcctatagctaagtggatggggttccctgagcctaagtatgcagggcattgtggtcttcgaggccttgcattctttcccggtggccataaatttgaaccaaaactgaatcaaatctatggaagagggcagcgtgctggaattgttcctatttctcctacaaaagtctactggtttgtctgcttcaacaggccatctccaggtccaaaaataaatgacccagctgtgctaaagaagctagctagagaactggtaacaaactggccttcagacctgttggacattatagaccataccccggatgacacaattagtcgaacaccactagtagaccggtggctgtggccatccatcagccctccggcttcagcaggaagagttgtgctggttggagatgcttggcatccaatgactcccaatcttggacaaggcgcttgttgtgctttggaagattcagtaattttggcacgaaagcttgcagcggcgattgactcaggaccagcagccattgaagatgctctcagctcatatggaaatgcaagatggcctcgaatttttcc

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009526 GO:0009534 GO:0009535 GO:0009536 GO:0009579 GO:0009941 GO:0016020 GO:0031090 GO:0031967 GO:0031969 GO:0031975 GO:0031976 GO:0031984 GO:0034357 GO:0042170 GO:0042651 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044436 GO:0044444 GO:0044446 GO:0044464 GO:0055035

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FAD_binding_3

Protein Analysis

224

Amino Acids

24.29

Weight (kDa)

8.59

Isoelectric Point (pI)

46.17

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012148)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G35660 AT2G35660 AT2G35660
fragaria_vesca	FvH4_5g20080
malus_domestica	MD06G1049200.v1.1
prunus_persica	Prupe.5G059700_v2.0.a1 Prupe.5G059700_v2.0.a1
rosa_chinensis	RchiOBHm_Chr7g0204941
rosa_laevigata	RLG00000003420
rosa_multiflora	Rmu_co8273435.1_g000001 Rmu_sc0002180.1_g000002
rosa_roxburghii	Rroxscaffold_3G00252650
rosa_rugosa	Rorug07G0086700 Rorug07G0086800
rosa_samantha	Rh7AG217400 Rh7BG214300 Rh7CG230700 Rh7DG225000
rosa_wichuraiana	Rw7G018860

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	279, 441
AciI	CCGC	1 cut(s)	593
AcoI	YGGCCR	2 cut(s)	196, 455
AcsI	RAATTY	3 cut(s)	105, 203, 663
AcuI	CTGAAG	2 cut(s)	363, 462
AfaI	GTAC	1 cut(s)	67
AfiI	CCNNNNNNNGG	3 cut(s)	311, 409, 533
AgeI	ACCGGT	1 cut(s)	444
AgsI	TTSAA	4 cut(s)	6, 209, 298, 623
AhlI	ACTAGT	1 cut(s)	436
AjnI	CCWGG	1 cut(s)	310
AluBI	AGCT	8 cut(s)	10, 73, 122, 335, 349, 353, 586, 636
AluI	AGCT	8 cut(s)	10, 73, 122, 335, 349, 353, 586, 636
Alw26I	GTCTC	2 cut(s)	33, 117
AoxI	GGCC	6 cut(s)	175, 196, 302, 374, 455, 656
ApeKI	GCWGC	4 cut(s)	49, 241, 590, 614
ApoI	RAATTY	3 cut(s)	105, 203, 663
AsiGI	ACCGGT	1 cut(s)	444
AspLEI	GCGC	1 cut(s)	545
AspS9I	GGNCC	2 cut(s)	314, 608
AsuC2I	CCSGG	2 cut(s)	192, 410
AsuNHI	GCTAGC	1 cut(s)	349
AvaII	GGWCC	2 cut(s)	314, 608
BalI	TGGCCA	2 cut(s)	198, 457
BbsI	GAAGAC	1 cut(s)	161
BbvI	GCAGC	4 cut(s)	36, 253, 602, 626
BccI	CCATC	8 cut(s)	29, 56, 95, 124, 313, 466, 470, 648
BciT130I	CCWGG	1 cut(s)	312
BcnI	CCSGG	2 cut(s)	192, 410
BcoDI	GTCTC	2 cut(s)	33, 117
BcuI	ACTAGT	1 cut(s)	436
BfaI	CTAG	3 cut(s)	350, 354, 437
BfmI	CTRYAG	1 cut(s)	117
BfoI	RGCGCY	1 cut(s)	546
BisI	GCNGC	5 cut(s)	50, 242, 591, 594, 615
BlsI	GCNGC	5 cut(s)	51, 243, 592, 595, 616
Bme1390I	CCNGG	3 cut(s)	192, 312, 410
Bme18I	GGWCC	2 cut(s)	314, 608
BmgT120I	GGNCC	2 cut(s)	314, 608
BmiI	GGNNCC	1 cut(s)	137
BmrFI	CCNGG	3 cut(s)	192, 312, 410
BmsI	GCATC	3 cut(s)	496, 523, 616
BmtI	GCTAGC	1 cut(s)	353
BpiI	GAAGAC	1 cut(s)	161
BpmI	CTGGAG	1 cut(s)	294
Bpu10I	CCTNAGC	1 cut(s)	141
BpuMI	CCSGG	2 cut(s)	192, 410
BsaI	GGTCTC	1 cut(s)	117
BsaJI	CCNNGG	1 cut(s)	408
BsaWI	WCCGGW	1 cut(s)	444
Bsc4I	CCNNNNNNNGG	3 cut(s)	311, 409, 533
Bse118I	RCCGGY	1 cut(s)	444
Bse1I	ACTGG	3 cut(s)	287, 366, 377
BseBI	CCWGG	1 cut(s)	312
BseDI	CCNNGG	1 cut(s)	408
BseGI	GGATG	5 cut(s)	67, 135, 418, 458, 514
BseLI	CCNNNNNNNGG	3 cut(s)	311, 409, 533
BseMII	CTCAG	4 cut(s)	83, 132, 618, 646
BseNI	ACTGG	3 cut(s)	287, 366, 377
BseXI	GCAGC	4 cut(s)	36, 253, 602, 626
BseYI	CCCAGC	1 cut(s)	331
BshFI	GGCC	6 cut(s)	177, 198, 304, 376, 457, 658
BshTI	ACCGGT	1 cut(s)	444
BsiSI	CCGG	4 cut(s)	192, 410, 445, 473
BslI	CCNNNNNNNGG	3 cut(s)	311, 409, 533
BsmAI	GTCTC	2 cut(s)	33, 117
BsmI	GAATGC	1 cut(s)	182
BsnI	GGCC	6 cut(s)	177, 198, 304, 376, 457, 658
Bso31I	GGTCTC	1 cut(s)	117
BspACI	CCGC	1 cut(s)	593
BspANI	GGCC	6 cut(s)	177, 198, 304, 376, 457, 658
BspCNI	CTCAG	4 cut(s)	82, 133, 617, 645
BspLI	GGNNCC	1 cut(s)	137
BspOI	GCTAGC	1 cut(s)	353
BspTNI	GGTCTC	1 cut(s)	117
BsrFI	RCCGGY	1 cut(s)	444
BsrI	ACTGG	3 cut(s)	287, 366, 377
BssAI	RCCGGY	1 cut(s)	444
BssECI	CCNNGG	1 cut(s)	408
Bst2UI	CCWGG	1 cut(s)	312
Bst6I	CTCTTC	3 cut(s)	20, 229, 481
BstC8I	GCNNGC	4 cut(s)	12, 246, 351, 588
BstDEI	CTNAG	7 cut(s)	69, 81, 123, 141, 147, 604, 632
BstF5I	GGATG	5 cut(s)	67, 135, 418, 458, 514
BstH2I	RGCGCY	1 cut(s)	546
BstHHI	GCGC	1 cut(s)	545
BstMAI	GTCTC	2 cut(s)	33, 117
BstMWI	GCNNNNNNNGC	2 cut(s)	346, 551
BstNI	CCWGG	1 cut(s)	312
BstSCI	CCNGG	3 cut(s)	190, 310, 408
BstSFI	CTRYAG	1 cut(s)	117
BstV1I	GCAGC	4 cut(s)	36, 253, 602, 626
BstV2I	GAAGAC	1 cut(s)	161
BsuRI	GGCC	6 cut(s)	177, 198, 304, 376, 457, 658
BtsCI	GGATG	5 cut(s)	67, 135, 418, 458, 514
Cac8I	GCNNGC	4 cut(s)	12, 246, 351, 588
CfoI	GCGC	1 cut(s)	545
Cfr10I	RCCGGY	1 cut(s)	444
Cfr13I	GGNCC	2 cut(s)	314, 608
Csp6I	GTAC	1 cut(s)	66
CspAI	ACCGGT	1 cut(s)	444
CviQI	GTAC	1 cut(s)	66
DdeI	CTNAG	7 cut(s)	69, 81, 123, 141, 147, 604, 632
EaeI	YGGCCR	2 cut(s)	196, 455
Eam1104I	CTCTTC	3 cut(s)	20, 229, 481
EarI	CTCTTC	3 cut(s)	20, 229, 481
Eco147I	AGGCCT	1 cut(s)	177
Eco31I	GGTCTC	1 cut(s)	117
Eco47I	GGWCC	2 cut(s)	314, 608
Eco57I	CTGAAG	2 cut(s)	363, 462
EcoRI	GAATTC	1 cut(s)	105
EcoRII	CCWGG	1 cut(s)	310
FaiI	YATR	8 cut(s)	119, 153, 201, 231, 398, 405, 640, 642
FauNDI	CATATG	1 cut(s)	640
FblI	GTMKAC	2 cut(s)	279, 441
Fnu4HI	GCNGC	5 cut(s)	50, 242, 591, 594, 615
FokI	GGATG	5 cut(s)	74, 142, 425, 445, 501
Fsp4HI	GCNGC	5 cut(s)	50, 242, 591, 594, 615
FspBI	CTAG	3 cut(s)	350, 354, 437
GlaI	GCGC	1 cut(s)	544
GluI	GCNGC	5 cut(s)	50, 242, 591, 594, 615
GsaI	CCCAGC	1 cut(s)	335
GsuI	CTGGAG	1 cut(s)	294
HaeII	RGCGCY	1 cut(s)	546
HaeIII	GGCC	6 cut(s)	177, 198, 304, 376, 457, 658
HapII	CCGG	4 cut(s)	192, 410, 445, 473
HhaI	GCGC	1 cut(s)	545
Hin6I	GCGC	1 cut(s)	543
HinP1I	GCGC	1 cut(s)	543
HindIII	AAGCTT	2 cut(s)	8, 584
HinfI	GANTC	4 cut(s)	220, 523, 563, 602
HpaII	CCGG	4 cut(s)	192, 410, 445, 473
Hpy166II	GTNNAC	2 cut(s)	280, 442
Hpy188I	TCNGA	1 cut(s)	382
Hpy188III	TCNNGA	1 cut(s)	606
Hpy8I	GTNNAC	2 cut(s)	280, 442
HpyAV	CCTTC	1 cut(s)	387
HpyCH4V	TGCA	6 cut(s)	14, 52, 155, 182, 590, 650
HpyF10VI	GCNNNNNNNGC	2 cut(s)	346, 551
HpyF3I	CTNAG	7 cut(s)	69, 81, 123, 141, 147, 604, 632
HspAI	GCGC	1 cut(s)	543
Lsp1109I	GCAGC	4 cut(s)	36, 253, 602, 626
LweI	GCATC	3 cut(s)	496, 523, 616
MaeI	CTAG	3 cut(s)	350, 354, 437
MaeIII	GTNAC	1 cut(s)	364
MboII	GAAGA	7 cut(s)	37, 44, 161, 246, 498, 572, 635
MlsI	TGGCCA	2 cut(s)	198, 457
MluCI	AATT	7 cut(s)	90, 105, 203, 252, 420, 570, 663
MluNI	TGGCCA	2 cut(s)	198, 457
MlyI	GAGTC	2 cut(s)	517, 596
MmeI	TCCRAC	2 cut(s)	369, 481
MnlI	CCTC	4 cut(s)	167, 230, 480, 669
Mox20I	TGGCCA	2 cut(s)	198, 457
MscI	TGGCCA	2 cut(s)	198, 457
Msp20I	TGGCCA	2 cut(s)	198, 457
MspA1I	CMGCKG	2 cut(s)	335, 593
MspI	CCGG	4 cut(s)	192, 410, 445, 473
MspR9I	CCNGG	3 cut(s)	192, 312, 410
Mva1269I	GAATGC	1 cut(s)	182
MvaI	CCWGG	1 cut(s)	312
MwoI	GCNNNNNNNGC	2 cut(s)	346, 551
NciI	CCSGG	2 cut(s)	192, 410
NdeI	CATATG	1 cut(s)	640
NheI	GCTAGC	1 cut(s)	349
NlaIV	GGNNCC	1 cut(s)	137
PceI	AGGCCT	1 cut(s)	177
PctI	GAATGC	1 cut(s)	182
PfeI	GAWTC	2 cut(s)	220, 563
PinAI	ACCGGT	1 cut(s)	444
PkrI	GCNGC	5 cut(s)	51, 243, 592, 595, 616
PleI	GAGTC	2 cut(s)	517, 596
PpsI	GAGTC	2 cut(s)	517, 596
Psp6I	CCWGG	1 cut(s)	310
PspFI	CCCAGC	1 cut(s)	331
PspGI	CCWGG	1 cut(s)	310
PspN4I	GGNNCC	1 cut(s)	137
PspPI	GGNCC	2 cut(s)	314, 608
PvuII	CAGCTG	1 cut(s)	335
RsaI	GTAC	1 cut(s)	67
RsaNI	GTAC	1 cut(s)	66
SatI	GCNGC	5 cut(s)	50, 242, 591, 594, 615
Sau96I	GGNCC	2 cut(s)	314, 608
SchI	GAGTC	2 cut(s)	517, 596
ScrFI	CCNGG	3 cut(s)	192, 312, 410
SfaNI	GCATC	3 cut(s)	496, 523, 616
SfcI	CTRYAG	1 cut(s)	117
SinI	GGWCC	2 cut(s)	314, 608
SpeI	ACTAGT	1 cut(s)	436
Sse9I	AATT	7 cut(s)	90, 105, 203, 252, 420, 570, 663
SseBI	AGGCCT	1 cut(s)	177
SsiI	CCGC	1 cut(s)	593
SspMI	CTAG	3 cut(s)	350, 354, 437
StuI	AGGCCT	1 cut(s)	177
StyD4I	CCNGG	3 cut(s)	190, 310, 408
TaqI	TCGA	3 cut(s)	172, 427, 661
TaqII	GACCGA	1 cut(s)	99
TasI	AATT	7 cut(s)	90, 105, 203, 252, 420, 570, 663
TauI	GCSGC	1 cut(s)	596
TfiI	GAWTC	2 cut(s)	220, 563
TseI	GCWGC	4 cut(s)	49, 241, 590, 614
VpaK11BI	GGWCC	2 cut(s)	314, 608
XapI	RAATTY	3 cut(s)	105, 203, 663
XmiI	GTMKAC	2 cut(s)	279, 441
XspI	CTAG	3 cut(s)	350, 354, 437

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.