Rmu_co8283033.1_g000001

Belongs to the glycosyl hydrolase 31 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8283033.1
OG0019741
Physical Location & Seq
Forward (+)
1 .. 827
827 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8283033.1_g000001.1.cds

Sequence Viewer

Length: 670 bp
ctatgaaaccaaagaaagactaagaattcgaataacagactcgagtaaccaaagatgggaaatcccacaagaccttctccctcgacaaactccacaaacatcccaccattcgatccccgaaaacgatctcattttcaccctccacaccaccgccccgtttggcttcacggtcacccgccgcttctccaatgatgtcgtattcgacgccaccccaaacccctccaacccttcctccatcctcgtcttcaaggaccagtacatccagctttcctcctctctcccggaaacccgatcttccctgtacggcctcggcgagcacaccaaagcctccttcaagctccaatccaatcagactctaacactctggactgccgacattttcagctccatccccgacctcaatctctatgggtcccacccattttacatggacgtgaggtcaccgtccggtgatgaaaaagttactgcaggaaccactcatggagttttgctattgaatagtaatggcatggatgtaaattacgacggcgacaggattacatataaagtgattggcggagttgttgacttgtattttttttctgggccgacgccggagttggtgatggagcaatacacggagttcattggccgacctgccccgatgccctactggtcttttggtaagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00052 ko00500 ko01100 map00052 map00500 map01100
Pfam Domains
Protein Families
Gal_mutarotas_2 Glyco_hydro_31 NtCtMGAM_N

Protein Analysis

222

Amino Acids

25.09

Weight (kDa)

5.46

Isoelectric Point (pI)

45.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019741)

Species Orthologous Gene IDs
malus_domestica MD10G1240300.v1.1
rosa_chinensis RchiOBHm_Chr5g0018621 RchiOBHm_Chr5g0020521
rosa_multiflora Rmu_co8282331.1_g000001 Rmu_co8283033.1_g000001 Rmu_sc0007192.1_g000001
rosa_samantha Rh5DG136500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 644
AciI CCGC 4 cut(s) 151, 176, 179, 556
AclWI GGATC 1 cut(s) 107
AcoI YGGCCR 1 cut(s) 629
AcsI RAATTY 1 cut(s) 25
AcyI GRCGYC 2 cut(s) 205, 591
AfaI GTAC 2 cut(s) 258, 303
AfiI CCNNNNNNNGG 1 cut(s) 56
AgsI TTSAA 3 cut(s) 248, 335, 497
AhdI GACNNNNNGTC 1 cut(s) 437
AjiI CACGTC 1 cut(s) 434
AjuI GAANNNNNNNTTGG 2 cut(s) 315, 347
AluBI AGCT 3 cut(s) 266, 338, 385
AluI AGCT 3 cut(s) 266, 338, 385
Alw21I GWGCWC 1 cut(s) 319
AlwI GGATC 1 cut(s) 107
Ama87I CYCGRG 1 cut(s) 41
AoxI GGCC 3 cut(s) 305, 585, 629
ApoI RAATTY 1 cut(s) 25
ArsI GACNNNNNNTTYG 2 cut(s) 10, 42
AspS9I GGNCC 3 cut(s) 251, 412, 585
AsuC2I CCSGG 1 cut(s) 282
AsuHPI GGTGA 5 cut(s) 128, 164, 433, 462, 614
AsuII TTCGAA 1 cut(s) 29
AvaI CYCGRG 1 cut(s) 41
AvaII GGWCC 2 cut(s) 251, 412
BbsI GAAGAC 1 cut(s) 236
Bbv12I GWGCWC 1 cut(s) 319
BccI CCATC 4 cut(s) 49, 243, 396, 599
BceAI ACGGC 2 cut(s) 320, 542
BcnI CCSGG 1 cut(s) 282
BfmI CTRYAG 1 cut(s) 466
BfuAI ACCTGC 1 cut(s) 644
BisI GCNGC 1 cut(s) 179
BlsI GCNGC 1 cut(s) 180
Bme1390I CCNGG 1 cut(s) 282
Bme18I GGWCC 2 cut(s) 251, 412
BmeRI GACNNNNNGTC 1 cut(s) 437
BmeT110I CYCGRG 1 cut(s) 41
BmgBI CACGTC 1 cut(s) 434
BmgT120I GGNCC 3 cut(s) 251, 412, 585
BmiI GGNNCC 3 cut(s) 413, 414, 473
BmrFI CCNGG 1 cut(s) 282
BmsI GCATC 1 cut(s) 634
BpiI GAAGAC 1 cut(s) 236
Bpu14I TTCGAA 1 cut(s) 29
BpuMI CCSGG 1 cut(s) 282
BsaHI GRCGYC 2 cut(s) 205, 591
BsaJI CCNNGG 1 cut(s) 308
BsaWI WCCGGW 1 cut(s) 447
BsaXI ACNNNNNCTCC 2 cut(s) 216, 246
Bsc4I CCNNNNNNNGG 1 cut(s) 56
Bse1I ACTGG 2 cut(s) 254, 657
BseDI CCNNGG 1 cut(s) 308
BseGI GGATG 5 cut(s) 99, 235, 259, 388, 518
BseLI CCNNNNNNNGG 1 cut(s) 56
BseNI ACTGG 2 cut(s) 254, 657
BseRI GAGGAG 1 cut(s) 263
BshFI GGCC 3 cut(s) 307, 587, 631
BsiHKAI GWGCWC 1 cut(s) 319
BsiHKCI CYCGRG 1 cut(s) 41
BsiSI CCGG 3 cut(s) 282, 448, 594
BslFI GGGAC 1 cut(s) 398
BslI CCNNNNNNNGG 1 cut(s) 56
BsmFI GGGAC 1 cut(s) 398
BsnI GGCC 3 cut(s) 307, 587, 631
BsoBI CYCGRG 1 cut(s) 41
Bsp119I TTCGAA 1 cut(s) 29
Bsp1286I GDGCHC 1 cut(s) 319
Bsp143I GATC 3 cut(s) 112, 125, 291
BspACI CCGC 4 cut(s) 151, 176, 179, 556
BspANI GGCC 3 cut(s) 307, 587, 631
BspLI GGNNCC 3 cut(s) 413, 414, 473
BspMAI CTGCAG 1 cut(s) 470
BspMI ACCTGC 1 cut(s) 644
BspPI GGATC 1 cut(s) 107
BspT104I TTCGAA 1 cut(s) 29
BsrI ACTGG 2 cut(s) 254, 657
BssECI CCNNGG 1 cut(s) 308
BssMI GATC 3 cut(s) 112, 125, 291
BssNI GRCGYC 2 cut(s) 205, 591
Bst4CI ACNGT 2 cut(s) 170, 445
BstACI GRCGYC 2 cut(s) 205, 591
BstBI TTCGAA 1 cut(s) 29
BstC8I GCNNGC 1 cut(s) 315
BstDEI CTNAG 1 cut(s) 21
BstEII GGTNACC 2 cut(s) 170, 439
BstF5I GGATG 5 cut(s) 99, 235, 259, 388, 518
BstKTI GATC 3 cut(s) 115, 128, 294
BstMBI GATC 3 cut(s) 112, 125, 291
BstPI GGTNACC 2 cut(s) 170, 439
BstSCI CCNGG 1 cut(s) 280
BstSFI CTRYAG 1 cut(s) 466
BstV2I GAAGAC 1 cut(s) 236
BsuRI GGCC 3 cut(s) 307, 587, 631
BtrI CACGTC 1 cut(s) 434
BtsCI GGATG 5 cut(s) 99, 235, 259, 388, 518
BveI ACCTGC 1 cut(s) 644
Cac8I GCNNGC 1 cut(s) 315
Cfr13I GGNCC 3 cut(s) 251, 412, 585
CseI GACGC 2 cut(s) 213, 599
Csp6I GTAC 2 cut(s) 257, 302
CviAII CATG 3 cut(s) 428, 480, 509
CviJI RGCY 8 cut(s) 163, 266, 307, 327, 338, 385, 587, 631
CviKI_1 RGCY 8 cut(s) 163, 266, 307, 327, 338, 385, 587, 631
CviQI GTAC 2 cut(s) 257, 302
DdeI CTNAG 1 cut(s) 21
DpnI GATC 3 cut(s) 114, 127, 293
DpnII GATC 3 cut(s) 112, 125, 291
DriI GACNNNNNGTC 1 cut(s) 437
EaeI YGGCCR 1 cut(s) 629
Eam1105I GACNNNNNGTC 1 cut(s) 437
EciI GGCGGA 1 cut(s) 571
Eco47I GGWCC 2 cut(s) 251, 412
Eco88I CYCGRG 1 cut(s) 41
Eco91I GGTNACC 2 cut(s) 170, 439
EcoO109I RGGNCCY 1 cut(s) 412
EcoO65I GGTNACC 2 cut(s) 170, 439
EcoRI GAATTC 1 cut(s) 25
FaeI CATG 3 cut(s) 431, 483, 512
FaiI YATR 7 cut(s) 4, 409, 429, 481, 510, 542, 544
FaqI GGGAC 1 cut(s) 398
FatI CATG 3 cut(s) 427, 479, 508
FauI CCCGC 1 cut(s) 183
Fnu4HI GCNGC 1 cut(s) 179
FokI GGATG 5 cut(s) 86, 222, 246, 375, 525
Fsp4HI GCNGC 1 cut(s) 179
GluI GCNGC 1 cut(s) 179
HaeIII GGCC 3 cut(s) 307, 587, 631
HapII CCGG 3 cut(s) 282, 448, 594
HgaI GACGC 2 cut(s) 213, 599
Hin1I GRCGYC 2 cut(s) 205, 591
Hin1II CATG 3 cut(s) 431, 483, 512
HincII GTYRAC 1 cut(s) 566
HindII GTYRAC 1 cut(s) 566
HinfI GANTC 2 cut(s) 39, 353
HpaII CCGG 3 cut(s) 282, 448, 594
HphI GGTGA 5 cut(s) 128, 164, 433, 462, 614
Hpy166II GTNNAC 1 cut(s) 566
Hpy188I TCNGA 1 cut(s) 352
Hpy188III TCNNGA 1 cut(s) 365
Hpy8I GTNNAC 1 cut(s) 566
Hpy99I CGWCG 3 cut(s) 207, 528, 593
HpyAV CCTTC 3 cut(s) 84, 238, 341
HpyCH4III ACNGT 2 cut(s) 170, 445
HpyCH4IV ACGT 1 cut(s) 433
HpyCH4V TGCA 1 cut(s) 468
HpyF3I CTNAG 1 cut(s) 21
HpySE526I ACGT 1 cut(s) 433
Hsp92I GRCGYC 2 cut(s) 205, 591
Hsp92II CATG 3 cut(s) 431, 483, 512
KflI GGGWCCC 1 cut(s) 412
Kzo9I GATC 3 cut(s) 112, 125, 291
LmnI GCTCC 3 cut(s) 343, 390, 608
LweI GCATC 1 cut(s) 634
MaeII ACGT 1 cut(s) 433
MaeIII GTNAC 4 cut(s) 45, 170, 439, 461
MalI GATC 3 cut(s) 114, 127, 293
MboI GATC 3 cut(s) 112, 125, 291
MboII GAAGA 2 cut(s) 236, 286
MhlI GDGCHC 1 cut(s) 319
MluCI AATT 2 cut(s) 25, 518
MlyI GAGTC 2 cut(s) 33, 347
MmeI TCCRAC 1 cut(s) 247
MslI CAYNNNNRTG 1 cut(s) 432
MspI CCGG 3 cut(s) 282, 448, 594
MspR9I CCNGG 1 cut(s) 282
NciI CCSGG 1 cut(s) 282
NdeII GATC 3 cut(s) 112, 125, 291
NlaIII CATG 3 cut(s) 431, 483, 512
NlaIV GGNNCC 3 cut(s) 413, 414, 473
NmeAIII GCCGAG 1 cut(s) 289
NmuCI GTSAC 2 cut(s) 170, 439
NspV TTCGAA 1 cut(s) 29
PaeR7I CTCGAG 1 cut(s) 41
PcsI WCGNNNNNNNCGW 1 cut(s) 310
PfoI TCCNGGA 1 cut(s) 280
PkrI GCNGC 1 cut(s) 180
PleI GAGTC 2 cut(s) 33, 347
PpsI GAGTC 2 cut(s) 33, 347
PpuMI RGGWCCY 1 cut(s) 412
Psp5II RGGWCCY 1 cut(s) 412
PspEI GGTNACC 2 cut(s) 170, 439
PspN4I GGNNCC 3 cut(s) 413, 414, 473
PspPI GGNCC 3 cut(s) 251, 412, 585
PspPPI RGGWCCY 1 cut(s) 412
PspXI VCTCGAGB 1 cut(s) 41
PstI CTGCAG 1 cut(s) 470
RsaI GTAC 2 cut(s) 258, 303
RsaNI GTAC 2 cut(s) 257, 302
RseI CAYNNNNRTG 1 cut(s) 432
SatI GCNGC 1 cut(s) 179
Sau3AI GATC 3 cut(s) 112, 125, 291
Sau96I GGNCC 3 cut(s) 251, 412, 585
SchI GAGTC 2 cut(s) 33, 347
ScrFI CCNGG 1 cut(s) 282
SduI GDGCHC 1 cut(s) 319
SetI ASST 8 cut(s) 76, 268, 340, 387, 400, 436, 441, 638
SfaNI GCATC 1 cut(s) 634
SfcI CTRYAG 1 cut(s) 466
Sfr274I CTCGAG 1 cut(s) 41
SfuI TTCGAA 1 cut(s) 29
SinI GGWCC 2 cut(s) 251, 412
SlaI CTCGAG 1 cut(s) 41
SmiMI CAYNNNNRTG 1 cut(s) 432
SmlI CTYRAG 1 cut(s) 41
SmoI CTYRAG 1 cut(s) 41
Sse9I AATT 2 cut(s) 25, 518
SsiI CCGC 4 cut(s) 151, 176, 179, 556
StyD4I CCNGG 1 cut(s) 280
TaaI ACNGT 2 cut(s) 170, 445
TaiI ACGT 1 cut(s) 436
TaqI TCGA 5 cut(s) 29, 42, 83, 111, 202
TasI AATT 2 cut(s) 25, 518
TatI WGTACW 1 cut(s) 256
TauI GCSGC 1 cut(s) 181
TseFI GTSAC 2 cut(s) 170, 439
Tsp45I GTSAC 2 cut(s) 170, 439
TspDTI ATGAA 3 cut(s) 19, 469, 614
TspGWI ACGGA 1 cut(s) 633
VpaK11BI GGWCC 2 cut(s) 251, 412
XapI RAATTY 1 cut(s) 25
XhoI CTCGAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.