Rmu_co8304723.1_g000001

The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8304723.1
Physical Location & Seq
Reverse (-)
233 .. 841
609 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8304723.1_g000001.1.cds

Sequence Viewer

Length: 609 bp
atgggtgtggaaaagctcattgcatcaaagatgatgctgcctggttccaacagaagaattcattctgttcatcgccactctggcatggctgtggcaggattagcagctgatggcaggcagattgttgccaggacaaagtcggaagctaccaactatgaaaatgtgtatggtgatcagattcctatcaaggaacttgctgaacgtgttgccagttatgtgcatctgtgcacactatattggtggctcagaccttttggatgtgggatcatccttggaggttatgacagagatgggccacaattgtacatggttgaaccttctggtgtttcttacaggtattttggtgcagcaattgggaagggaaggcaggctgctaaaacagagattgaaaagttgaagctttcggaattgacttgtcggcaaggtgttattgaagtagccaagatcatttatggaatacacgatgaggcgaaggacaaagactttgaattggaaatgagctgggtctgcgatgaatcgaaccgtctgcatcagaaggttccagatgagcttctagaggaagcaaaggcagcggcaagagcagcattggaagaaatggatgcagactaa

Protein Analysis

202

Amino Acids

22.54

Weight (kDa)

5.91

Isoelectric Point (pI)

37.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014407)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 572
AclWI GGATC 1 cut(s) 272
AcsI RAATTY 1 cut(s) 57
AfaI GTAC 1 cut(s) 305
AflIII ACRYGT 1 cut(s) 202
AgsI TTSAA 5 cut(s) 314, 389, 397, 434, 488
AjnI CCWGG 2 cut(s) 40, 128
AluBI AGCT 6 cut(s) 16, 107, 146, 400, 501, 550
AluI AGCT 6 cut(s) 16, 107, 146, 400, 501, 550
Alw21I GWGCWC 1 cut(s) 230
Alw44I GTGCAC 1 cut(s) 226
AlwI GGATC 1 cut(s) 272
AoxI GGCC 1 cut(s) 293
ApaLI GTGCAC 1 cut(s) 226
ApeKI GCWGC 6 cut(s) 37, 104, 347, 371, 569, 581
ApoI RAATTY 1 cut(s) 57
ArsI GACNNNNNNTTYG 2 cut(s) 467, 499
Asp700I GAANNNNTTC 1 cut(s) 61
AspS9I GGNCC 1 cut(s) 293
AsuHPI GGTGA 1 cut(s) 182
BaeGI GKGCMC 1 cut(s) 230
Bbv12I GWGCWC 1 cut(s) 230
BbvI GCAGC 6 cut(s) 24, 116, 358, 359, 581, 593
BccI CCATC 2 cut(s) 104, 284
BcgI CGANNNNNNTGC 2 cut(s) 508, 542
BciT130I CCWGG 2 cut(s) 42, 130
BclI TGATCA 1 cut(s) 172
BfaI CTAG 1 cut(s) 554
BglI GCCNNNNNGGC 1 cut(s) 81
BisI GCNGC 7 cut(s) 38, 105, 348, 372, 570, 573, 582
BlsI GCNGC 7 cut(s) 39, 106, 349, 373, 571, 574, 583
Bme1390I CCNGG 2 cut(s) 42, 130
BmgT120I GGNCC 1 cut(s) 293
BmiI GGNNCC 2 cut(s) 46, 540
BmrFI CCNGG 2 cut(s) 42, 130
BmsI GCATC 5 cut(s) 24, 32, 229, 538, 589
BsaBI GATNNNNATC 1 cut(s) 182
BsaJI CCNNGG 1 cut(s) 271
Bse1I ACTGG 1 cut(s) 210
Bse3DI GCAATG 1 cut(s) 18
Bse8I GATNNNNATC 1 cut(s) 182
BseBI CCWGG 2 cut(s) 42, 130
BseDI CCNNGG 1 cut(s) 271
BseGI GGATG 3 cut(s) 263, 267, 604
BseJI GATNNNNATC 1 cut(s) 182
BseMI GCAATG 1 cut(s) 18
BseMII CTCAG 1 cut(s) 259
BseNI ACTGG 1 cut(s) 210
BseSI GKGCMC 1 cut(s) 230
BseXI GCAGC 6 cut(s) 24, 116, 358, 359, 581, 593
BseYI CCCAGC 1 cut(s) 501
BsgI GTGCAG 1 cut(s) 366
BshFI GGCC 1 cut(s) 295
BsiHKAI GWGCWC 1 cut(s) 230
BsnI GGCC 1 cut(s) 295
Bsp1286I GDGCHC 1 cut(s) 230
Bsp1407I TGTACA 1 cut(s) 303
Bsp143I GATC 3 cut(s) 172, 264, 444
BspACI CCGC 1 cut(s) 572
BspANI GGCC 1 cut(s) 295
BspCNI CTCAG 1 cut(s) 258
BspLI GGNNCC 2 cut(s) 46, 540
BspPI GGATC 1 cut(s) 272
BsrDI GCAATG 1 cut(s) 18
BsrGI TGTACA 1 cut(s) 303
BsrI ACTGG 1 cut(s) 210
BssECI CCNNGG 1 cut(s) 271
BssMI GATC 3 cut(s) 172, 264, 444
BssT1I CCWWGG 1 cut(s) 271
Bst2UI CCWGG 2 cut(s) 42, 130
Bst4CI ACNGT 1 cut(s) 524
BstAUI TGTACA 1 cut(s) 303
BstC8I GCNNGC 2 cut(s) 116, 369
BstDEI CTNAG 1 cut(s) 245
BstF5I GGATG 3 cut(s) 263, 267, 604
BstKTI GATC 3 cut(s) 175, 267, 447
BstMBI GATC 3 cut(s) 172, 264, 444
BstMWI GCNNNNNNNGC 6 cut(s) 81, 101, 507, 569, 578, 581
BstNI CCWGG 2 cut(s) 42, 130
BstSCI CCNGG 2 cut(s) 40, 128
BstSLI GKGCMC 1 cut(s) 230
BstV1I GCAGC 6 cut(s) 24, 116, 358, 359, 581, 593
BsuRI GGCC 1 cut(s) 295
BtgZI GCGATG 2 cut(s) 56, 525
BtsCI GGATG 3 cut(s) 263, 267, 604
Cac8I GCNNGC 2 cut(s) 116, 369
Cfr13I GGNCC 1 cut(s) 293
Csp6I GTAC 1 cut(s) 304
CviAII CATG 2 cut(s) 85, 307
CviQI GTAC 1 cut(s) 304
DdeI CTNAG 1 cut(s) 245
DpnI GATC 3 cut(s) 174, 266, 446
DpnII GATC 3 cut(s) 172, 264, 444
Eco130I CCWWGG 1 cut(s) 271
EcoRI GAATTC 1 cut(s) 57
EcoRII CCWGG 2 cut(s) 40, 128
EcoT14I CCWWGG 1 cut(s) 271
ErhI CCWWGG 1 cut(s) 271
FaeI CATG 2 cut(s) 88, 310
FaiI YATR 8 cut(s) 86, 156, 168, 216, 235, 282, 308, 453
FatI CATG 2 cut(s) 84, 306
FbaI TGATCA 1 cut(s) 172
Fnu4HI GCNGC 7 cut(s) 38, 105, 348, 372, 570, 573, 582
FokI GGATG 2 cut(s) 254, 270
Fsp4HI GCNGC 7 cut(s) 38, 105, 348, 372, 570, 573, 582
FspBI CTAG 1 cut(s) 554
GluI GCNGC 7 cut(s) 38, 105, 348, 372, 570, 573, 582
GsaI CCCAGC 1 cut(s) 505
HaeIII GGCC 1 cut(s) 295
Hin1II CATG 2 cut(s) 88, 310
HindIII AAGCTT 1 cut(s) 398
HinfI GANTC 2 cut(s) 178, 515
HphI GGTGA 1 cut(s) 182
Hpy166II GTNNAC 1 cut(s) 228
Hpy188I TCNGA 5 cut(s) 142, 177, 248, 406, 534
Hpy188III TCNNGA 2 cut(s) 542, 554
Hpy8I GTNNAC 1 cut(s) 228
HpyAV CCTTC 5 cut(s) 327, 352, 357, 466, 529
HpyCH4III ACNGT 1 cut(s) 524
HpyCH4IV ACGT 1 cut(s) 202
HpyCH4V TGCA 6 cut(s) 23, 220, 228, 347, 529, 602
HpyF10VI GCNNNNNNNGC 6 cut(s) 81, 101, 507, 569, 578, 581
HpyF3I CTNAG 1 cut(s) 245
HpySE526I ACGT 1 cut(s) 202
Hsp92II CATG 2 cut(s) 88, 310
Ksp22I TGATCA 1 cut(s) 172
Kzo9I GATC 3 cut(s) 172, 264, 444
Lsp1109I GCAGC 6 cut(s) 24, 116, 358, 359, 581, 593
LweI GCATC 5 cut(s) 24, 32, 229, 538, 589
MaeI CTAG 1 cut(s) 554
MaeII ACGT 1 cut(s) 202
MalI GATC 3 cut(s) 174, 266, 446
MboI GATC 3 cut(s) 172, 264, 444
MboII GAAGA 2 cut(s) 66, 602
MfeI CAATTG 2 cut(s) 299, 351
MhlI GDGCHC 1 cut(s) 230
MluCI AATT 5 cut(s) 57, 299, 351, 407, 488
MmeI TCCRAC 2 cut(s) 72, 120
MnlI CCTC 3 cut(s) 269, 460, 550
MroXI GAANNNNTTC 1 cut(s) 61
MslI CAYNNNNRTG 1 cut(s) 89
MspA1I CMGCKG 2 cut(s) 107, 572
MspR9I CCNGG 2 cut(s) 42, 130
MunI CAATTG 2 cut(s) 299, 351
MvaI CCWGG 2 cut(s) 42, 130
MwoI GCNNNNNNNGC 6 cut(s) 81, 101, 507, 569, 578, 581
NdeII GATC 3 cut(s) 172, 264, 444
NlaIII CATG 2 cut(s) 88, 310
NlaIV GGNNCC 2 cut(s) 46, 540
PdmI GAANNNNTTC 1 cut(s) 61
PfeI GAWTC 2 cut(s) 178, 515
PflFI GACNNNGTC 1 cut(s) 136
PkrI GCNGC 7 cut(s) 39, 106, 349, 373, 571, 574, 583
Psp6I CCWGG 2 cut(s) 40, 128
PspFI CCCAGC 1 cut(s) 501
PspGI CCWGG 2 cut(s) 40, 128
PspN4I GGNNCC 2 cut(s) 46, 540
PspPI GGNCC 1 cut(s) 293
PsyI GACNNNGTC 1 cut(s) 136
PvuII CAGCTG 1 cut(s) 107
RsaI GTAC 1 cut(s) 305
RsaNI GTAC 1 cut(s) 304
RseI CAYNNNNRTG 1 cut(s) 89
SatI GCNGC 7 cut(s) 38, 105, 348, 372, 570, 573, 582
Sau3AI GATC 3 cut(s) 172, 264, 444
Sau96I GGNCC 1 cut(s) 293
ScrFI CCNGG 2 cut(s) 42, 130
SduI GDGCHC 1 cut(s) 230
SfaNI GCATC 5 cut(s) 24, 32, 229, 538, 589
SmiMI CAYNNNNRTG 1 cut(s) 89
Sse9I AATT 5 cut(s) 57, 299, 351, 407, 488
SsiI CCGC 1 cut(s) 572
SspMI CTAG 1 cut(s) 554
StyD4I CCNGG 2 cut(s) 40, 128
StyI CCWWGG 1 cut(s) 271
TaaI ACNGT 1 cut(s) 524
TaiI ACGT 1 cut(s) 205
TaqI TCGA 1 cut(s) 518
TasI AATT 5 cut(s) 57, 299, 351, 407, 488
TatI WGTACW 1 cut(s) 303
TauI GCSGC 1 cut(s) 575
TfiI GAWTC 2 cut(s) 178, 515
TseI GCWGC 6 cut(s) 37, 104, 347, 371, 569, 581
TspDTI ATGAA 4 cut(s) 50, 59, 171, 528
Tth111I GACNNNGTC 1 cut(s) 136
VneI GTGCAC 1 cut(s) 226
XapI RAATTY 1 cut(s) 57
XbaI TCTAGA 1 cut(s) 553
XmnI GAANNNNTTC 1 cut(s) 61
XspI CTAG 1 cut(s) 554
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.