Rmu_co8313053.1_g000001

Tesmin/TSO1-like CXC domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8313053.1
Physical Location & Seq
Forward (+)
1 .. 388
388 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8313053.1_g000001.1.cds

Sequence Viewer

Length: 323 bp
ctggagtattttgtttggattcatgtgcatgtgaaaactgctacaacaagcctgagtttgaggacactgtttttgatgcacgtcagcaaattgaatcccgtaatccgctggcatttgctcccaaagttgtgaagcatgaaatcaactcttcgcctaacattatggtaactcctgttaaagcatttatctttccagggttgcttaattggaaatttgggagtattttgagcttgagaactctttgcaggaagaagcagactggacgaccccatcatcagctaggcacaagagaggttgcaattgcaagaagtcaaagtgcctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.91

Weight (kDa)

9.17

Isoelectric Point (pI)

67.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 106
AcsI RAATTY 1 cut(s) 211
AgsI TTSAA 1 cut(s) 94
AjiI CACGTC 1 cut(s) 82
AjnI CCWGG 1 cut(s) 192
AluBI AGCT 2 cut(s) 230, 279
AluI AGCT 2 cut(s) 230, 279
ApoI RAATTY 1 cut(s) 211
ArsI GACNNNNNNTTYG 2 cut(s) 55, 87
BccI CCATC 1 cut(s) 278
BciT130I CCWGG 1 cut(s) 194
BfaI CTAG 1 cut(s) 280
Bme1390I CCNGG 1 cut(s) 194
BmgBI CACGTC 1 cut(s) 82
BmrFI CCNGG 1 cut(s) 194
BmsI GCATC 1 cut(s) 66
BpmI CTGGAG 1 cut(s) 23
BpuEI CTTGAG 1 cut(s) 252
BsaJI CCNNGG 1 cut(s) 193
Bse1I ACTGG 1 cut(s) 264
BseBI CCWGG 1 cut(s) 194
BseDI CCNNGG 1 cut(s) 193
BseMII CTCAG 1 cut(s) 44
BseNI ACTGG 1 cut(s) 264
BspACI CCGC 1 cut(s) 106
BspCNI CTCAG 1 cut(s) 45
BsrI ACTGG 1 cut(s) 264
BssECI CCNNGG 1 cut(s) 193
Bst2UI CCWGG 1 cut(s) 194
Bst4CI ACNGT 1 cut(s) 69
Bst6I CTCTTC 1 cut(s) 153
BstC8I GCNNGC 1 cut(s) 110
BstDEI CTNAG 1 cut(s) 53
BstNI CCWGG 1 cut(s) 194
BstNSI RCATGY 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 192
BtrI CACGTC 1 cut(s) 82
BtsIMutI CAGTG 1 cut(s) 65
Cac8I GCNNGC 1 cut(s) 110
CviAII CATG 3 cut(s) 23, 29, 136
CviJI RGCY 3 cut(s) 51, 230, 279
CviKI_1 RGCY 3 cut(s) 51, 230, 279
DdeI CTNAG 1 cut(s) 53
Eam1104I CTCTTC 1 cut(s) 153
EarI CTCTTC 1 cut(s) 153
EcoRII CCWGG 1 cut(s) 192
FaeI CATG 3 cut(s) 26, 32, 139
FaiI YATR 4 cut(s) 24, 30, 137, 163
FatI CATG 3 cut(s) 22, 28, 135
FspBI CTAG 1 cut(s) 280
GsuI CTGGAG 1 cut(s) 23
Hin1II CATG 3 cut(s) 26, 32, 139
HinfI GANTC 2 cut(s) 19, 94
HpyCH4III ACNGT 1 cut(s) 69
HpyCH4IV ACGT 1 cut(s) 81
HpyCH4V TGCA 5 cut(s) 28, 79, 245, 298, 304
HpyF3I CTNAG 1 cut(s) 53
HpySE526I ACGT 1 cut(s) 81
Hsp92II CATG 3 cut(s) 26, 32, 139
LmnI GCTCC 1 cut(s) 123
LpnPI CCDG 7 cut(s) 65, 94, 179, 185, 206, 231, 245
LweI GCATC 1 cut(s) 66
MaeI CTAG 1 cut(s) 280
MaeII ACGT 1 cut(s) 81
MaeIII GTNAC 1 cut(s) 165
MboII GAAGA 2 cut(s) 140, 261
MfeI CAATTG 1 cut(s) 299
MluCI AATT 4 cut(s) 89, 204, 211, 299
MnlI CCTC 2 cut(s) 54, 285
MseI TTAA 2 cut(s) 176, 203
MslI CAYNNNNRTG 1 cut(s) 27
MspA1I CMGCKG 1 cut(s) 108
MspR9I CCNGG 1 cut(s) 194
MunI CAATTG 1 cut(s) 299
MvaI CCWGG 1 cut(s) 194
NlaIII CATG 3 cut(s) 26, 32, 139
NspI RCATGY 1 cut(s) 32
PfeI GAWTC 2 cut(s) 19, 94
Psp6I CCWGG 1 cut(s) 192
PspGI CCWGG 1 cut(s) 192
RseI CAYNNNNRTG 1 cut(s) 27
SaqAI TTAA 2 cut(s) 176, 203
ScrFI CCNGG 1 cut(s) 194
SetI ASST 4 cut(s) 84, 232, 281, 296
SfaNI GCATC 1 cut(s) 66
SmiMI CAYNNNNRTG 1 cut(s) 27
SmlI CTYRAG 1 cut(s) 231
SmoI CTYRAG 1 cut(s) 231
Sse9I AATT 4 cut(s) 89, 204, 211, 299
SsiI CCGC 1 cut(s) 106
SspMI CTAG 1 cut(s) 280
StyD4I CCNGG 1 cut(s) 192
TaaI ACNGT 1 cut(s) 69
TaiI ACGT 1 cut(s) 84
TasI AATT 4 cut(s) 89, 204, 211, 299
TfiI GAWTC 2 cut(s) 19, 94
Tru1I TTAA 2 cut(s) 176, 203
Tru9I TTAA 2 cut(s) 176, 203
TscAI CASTG 1 cut(s) 72
TspDTI ATGAA 2 cut(s) 11, 152
TspRI CASTG 1 cut(s) 72
XapI RAATTY 1 cut(s) 211
XceI RCATGY 1 cut(s) 32
XspI CTAG 1 cut(s) 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.