Rmu_co8349471.1_g000001

Transferase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8349471.1
Physical Location & Seq
Forward (+)
14 .. 1037
1024 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8349471.1_g000001.1.cds

Sequence Viewer

Length: 540 bp
atgcaccgcatggctttctctgtgatccgatcaagccaaagcctagttagaccatgcgagcagacaccgatcgccacccttgatttatcggaaatcgacagcttgcccgtcctaagaagcaacgctcgaacactgcatgtgtatagacatggggaatatcaccaagtagccaaacttataaaagaaggtttgtcgaaagcattggttccatattaccctcttgcaggacgactgaaagtgtctaatgttaatggtggaggtcagcttcaagttgaatgtagtggacaaggtgtgtggttggtcgaggcatatgctaattgttcacttgatgctgtcaattactttgatgatactgttgcctcccactcgaacaaatatgatgatcttcttcctcgaggagctgaaggacttgacctacttctacaaatgcaggtgactgaatttgaatgtggtggattcgtggttggcatcaaattcagccacagcatctgcgacggcttaggatctgcacagtttctcaatgctgttggcgagatggca
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

180

Amino Acids

19.63

Weight (kDa)

5.62

Isoelectric Point (pI)

43.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017176)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G62160
fragaria_vesca FvH4_1g26300
rosa_chinensis RchiOBHm_Chr3g0485971
rosa_laevigata RLG00000023118
rosa_multiflora Rmu_co8349471.1_g000001 Rmu_sc0000899.1_g000003
rosa_roxburghii Rroxscaffold_6G00396160
rosa_rugosa Rorug03G0223100
rosa_samantha Rh3AG272600 Rh3BG307200 Rh3CG305800 Rh3DG302100
rosa_wichuraiana Rw3G024170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 179
AarI CACCTGC 1 cut(s) 421
AbsI CCTCGAGG 1 cut(s) 393
Acc36I ACCTGC 1 cut(s) 421
AciI CCGC 1 cut(s) 7
AclWI GGATC 2 cut(s) 19, 511
AcsI RAATTY 2 cut(s) 440, 473
AcuI CTGAAG 1 cut(s) 423
AfiI CCNNNNNNNGG 1 cut(s) 224
AgsI TTSAA 3 cut(s) 269, 275, 446
AluBI AGCT 3 cut(s) 102, 265, 401
AluI AGCT 3 cut(s) 102, 265, 401
AlwI GGATC 2 cut(s) 19, 511
AlwNI CAGNNNCTG 1 cut(s) 489
Ama87I CYCGRG 1 cut(s) 393
ApoI RAATTY 2 cut(s) 440, 473
AsuHPI GGTGA 2 cut(s) 152, 445
AvaI CYCGRG 1 cut(s) 393
BccI CCATC 1 cut(s) 529
BceAI ACGGC 1 cut(s) 511
BcgI CGANNNNNNTGC 2 cut(s) 293, 327
BfaI CTAG 1 cut(s) 44
BfuAI ACCTGC 1 cut(s) 421
BmeT110I CYCGRG 1 cut(s) 393
BmiI GGNNCC 1 cut(s) 207
BmsI GCATC 3 cut(s) 319, 477, 495
Bpu10I CCTNAGC 1 cut(s) 499
Bsc4I CCNNNNNNNGG 1 cut(s) 224
BseLI CCNNNNNNNGG 1 cut(s) 224
BseRI GAGGAG 1 cut(s) 411
BsgI GTGCAG 1 cut(s) 492
Bsh1285I CGRYCG 1 cut(s) 72
BsiEI CGRYCG 1 cut(s) 72
BsiHKCI CYCGRG 1 cut(s) 393
BslI CCNNNNNNNGG 1 cut(s) 224
BsoBI CYCGRG 1 cut(s) 393
Bsp143I GATC 5 cut(s) 24, 29, 69, 382, 503
BspACI CCGC 1 cut(s) 7
BspLI GGNNCC 1 cut(s) 207
BspMI ACCTGC 1 cut(s) 421
BspPI GGATC 2 cut(s) 19, 511
BssMI GATC 5 cut(s) 24, 29, 69, 382, 503
Bst4CI ACNGT 2 cut(s) 355, 513
BstC8I GCNNGC 2 cut(s) 59, 104
BstDEI CTNAG 2 cut(s) 113, 499
BstENI CCTNNNNNAGG 1 cut(s) 222
BstKTI GATC 5 cut(s) 27, 32, 72, 385, 506
BstMBI GATC 5 cut(s) 24, 29, 69, 382, 503
BstMCI CGRYCG 1 cut(s) 72
BstNSI RCATGY 1 cut(s) 140
BstX2I RGATCY 1 cut(s) 503
BstYI RGATCY 1 cut(s) 503
BtsI GCAGTG 1 cut(s) 131
BtsIMutI CAGTG 1 cut(s) 131
BveI ACCTGC 1 cut(s) 421
Cac8I GCNNGC 2 cut(s) 59, 104
CaiI CAGNNNCTG 1 cut(s) 489
CspCI CAANNNNNGTGG 2 cut(s) 275, 310
CviAII CATG 4 cut(s) 10, 54, 137, 149
CviJI RGCY 9 cut(s) 14, 36, 42, 102, 170, 265, 401, 480, 498
CviKI_1 RGCY 9 cut(s) 14, 36, 42, 102, 170, 265, 401, 480, 498
DdeI CTNAG 2 cut(s) 113, 499
DpnI GATC 5 cut(s) 26, 31, 71, 384, 505
DpnII GATC 5 cut(s) 24, 29, 69, 382, 503
Eco57I CTGAAG 1 cut(s) 423
Eco88I CYCGRG 1 cut(s) 393
EcoNI CCTNNNNNAGG 1 cut(s) 222
FaeI CATG 4 cut(s) 13, 57, 140, 152
FatI CATG 4 cut(s) 9, 53, 136, 148
FauNDI CATATG 1 cut(s) 310
FspBI CTAG 1 cut(s) 44
Hin1II CATG 4 cut(s) 13, 57, 140, 152
HinfI GANTC 1 cut(s) 456
HphI GGTGA 2 cut(s) 152, 445
Hpy166II GTNNAC 2 cut(s) 284, 323
Hpy188I TCNGA 2 cut(s) 29, 91
Hpy8I GTNNAC 2 cut(s) 284, 323
Hpy99I CGWCG 1 cut(s) 497
HpyAV CCTTC 2 cut(s) 179, 398
HpyCH4III ACNGT 2 cut(s) 355, 513
HpyCH4V TGCA 5 cut(s) 4, 136, 224, 430, 509
HpyF3I CTNAG 2 cut(s) 113, 499
Hsp92II CATG 4 cut(s) 13, 57, 140, 152
Kzo9I GATC 5 cut(s) 24, 29, 69, 382, 503
LmnI GCTCC 1 cut(s) 398
LpnPI CCDG 2 cut(s) 210, 416
LweI GCATC 3 cut(s) 319, 477, 495
MaeI CTAG 1 cut(s) 44
MaeIII GTNAC 1 cut(s) 433
MalI GATC 5 cut(s) 26, 31, 71, 384, 505
MboI GATC 5 cut(s) 24, 29, 69, 382, 503
MboII GAAGA 2 cut(s) 377, 380
MflI RGATCY 1 cut(s) 503
MluCI AATT 4 cut(s) 316, 337, 440, 473
MnlI CCTC 6 cut(s) 228, 251, 298, 370, 389, 402
MseI TTAA 1 cut(s) 249
NdeI CATATG 1 cut(s) 310
NdeII GATC 5 cut(s) 24, 29, 69, 382, 503
NlaIII CATG 4 cut(s) 13, 57, 140, 152
NlaIV GGNNCC 1 cut(s) 207
NmuCI GTSAC 1 cut(s) 433
NspI RCATGY 1 cut(s) 140
PaeR7I CTCGAG 1 cut(s) 393
PaqCI CACCTGC 1 cut(s) 421
PfeI GAWTC 1 cut(s) 456
Ple19I CGATCG 1 cut(s) 72
PsiI TTATAA 1 cut(s) 179
PspN4I GGNNCC 1 cut(s) 207
PspXI VCTCGAGB 1 cut(s) 393
PstNI CAGNNNCTG 1 cut(s) 489
PsuI RGATCY 1 cut(s) 503
PvuI CGATCG 1 cut(s) 72
SaqAI TTAA 1 cut(s) 249
Sau3AI GATC 5 cut(s) 24, 29, 69, 382, 503
SetI ASST 8 cut(s) 104, 190, 262, 267, 292, 403, 417, 435
SfaNI GCATC 3 cut(s) 319, 477, 495
Sfr274I CTCGAG 1 cut(s) 393
SlaI CTCGAG 1 cut(s) 393
SmlI CTYRAG 1 cut(s) 393
SmoI CTYRAG 1 cut(s) 393
Sse9I AATT 4 cut(s) 316, 337, 440, 473
SsiI CCGC 1 cut(s) 7
SspMI CTAG 1 cut(s) 44
TaaI ACNGT 2 cut(s) 355, 513
TaqI TCGA 6 cut(s) 96, 127, 194, 303, 368, 394
TasI AATT 4 cut(s) 316, 337, 440, 473
TfiI GAWTC 1 cut(s) 456
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TscAI CASTG 1 cut(s) 138
TseFI GTSAC 1 cut(s) 433
Tsp45I GTSAC 1 cut(s) 433
TspRI CASTG 1 cut(s) 138
XagI CCTNNNNNAGG 1 cut(s) 222
XapI RAATTY 2 cut(s) 440, 473
XceI RCATGY 1 cut(s) 140
XhoI CTCGAG 1 cut(s) 393
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.