Rmu_co8428109.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8428109.1
Physical Location & Seq
Reverse (-)
309 .. 1000
692 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8428109.1_g000001.1.cds

Sequence Viewer

Length: 585 bp
atggatgatgttataccacaatccgagagccacgacctaacaactccttcaaatcataacccaaaaggtgatgaagctaaaggagaaggagggagagtaggtaatgggttcatcagcaacctgaaaatctctactttgagctctggagctgaagaacatggtggagatggagaaggtggtgaagatgaaggaaagggtggtgggcttataaccaacttcatctccaacttggtgtcaccaaggagtactaaagcaggggaggttactaagcgaaaagttgaagatgaagttgaagctggtgagattgttaatggtcagacagagcaagatgtgggtggtggtgaaaatggtggaggggtgatttcaaacatcatttccaacttctttcatgcaagtgaggaagagaaagaaggagagaaggtgaaagatggtggaaataaaaggttgaagatggaggaggaggaaggaggtaaaggaggcctcattgaaaacattgtctctcacttgcctacatcaattccagatgatgcagctccaacaactgatgaggcctccattcttattcactccattgtcaaagactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

194

Amino Acids

20.19

Weight (kDa)

4.55

Isoelectric Point (pI)

45.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014624)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 209
AcuI CTGAAG 1 cut(s) 171
AfaI GTAC 1 cut(s) 247
AgsI TTSAA 6 cut(s) 51, 281, 293, 366, 448, 488
AluBI AGCT 5 cut(s) 77, 141, 149, 296, 533
AluI AGCT 5 cut(s) 77, 141, 149, 296, 533
Alw21I GWGCWC 1 cut(s) 143
Alw26I GTCTC 1 cut(s) 502
AoxI GGCC 2 cut(s) 478, 549
ApeKI GCWGC 1 cut(s) 530
AsuHPI GGTGA 7 cut(s) 80, 191, 228, 311, 353, 370, 433
BanII GRGCYC 1 cut(s) 143
Bbv12I GWGCWC 1 cut(s) 143
BbvI GCAGC 1 cut(s) 542
BccI CCATC 3 cut(s) 161, 422, 445
BcoDI GTCTC 1 cut(s) 502
BfaI CTAG 1 cut(s) 583
BisI GCNGC 1 cut(s) 531
BlsI GCNGC 1 cut(s) 532
BmcAI AGTACT 1 cut(s) 247
BmsI GCATC 1 cut(s) 517
BpmI CTGGAG 1 cut(s) 165
BsaJI CCNNGG 1 cut(s) 239
BsaXI ACNNNNNCTCC 8 cut(s) 81, 85, 111, 115, 206, 236, 405, 435
BseDI CCNNGG 1 cut(s) 239
BseGI GGATG 1 cut(s) 10
BseRI GAGGAG 2 cut(s) 470, 473
BseXI GCAGC 1 cut(s) 542
BshFI GGCC 2 cut(s) 480, 551
BsiHKAI GWGCWC 1 cut(s) 143
BsmAI GTCTC 1 cut(s) 502
BsnI GGCC 2 cut(s) 480, 551
Bsp1286I GDGCHC 1 cut(s) 143
BspANI GGCC 2 cut(s) 480, 551
BssECI CCNNGG 1 cut(s) 239
BssT1I CCWWGG 1 cut(s) 239
Bst6I CTCTTC 1 cut(s) 396
BstDEI CTNAG 1 cut(s) 267
BstF5I GGATG 1 cut(s) 10
BstMAI GTCTC 1 cut(s) 502
BstV1I GCAGC 1 cut(s) 542
BsuRI GGCC 2 cut(s) 480, 551
BtsCI GGATG 1 cut(s) 10
Csp6I GTAC 1 cut(s) 246
CviAII CATG 2 cut(s) 158, 389
CviJI RGCY 9 cut(s) 30, 77, 141, 149, 205, 296, 480, 533, 551
CviKI_1 RGCY 9 cut(s) 30, 77, 141, 149, 205, 296, 480, 533, 551
CviQI GTAC 1 cut(s) 246
DdeI CTNAG 1 cut(s) 267
Eam1104I CTCTTC 1 cut(s) 396
EarI CTCTTC 1 cut(s) 396
Ecl136II GAGCTC 1 cut(s) 141
Eco130I CCWWGG 1 cut(s) 239
Eco147I AGGCCT 2 cut(s) 480, 551
Eco24I GRGCYC 1 cut(s) 143
Eco53kI GAGCTC 1 cut(s) 141
Eco57I CTGAAG 1 cut(s) 171
EcoICRI GAGCTC 1 cut(s) 141
EcoT14I CCWWGG 1 cut(s) 239
EcoT38I GRGCYC 1 cut(s) 143
ErhI CCWWGG 1 cut(s) 239
FaeI CATG 2 cut(s) 161, 392
FaiI YATR 5 cut(s) 14, 57, 159, 209, 390
FatI CATG 2 cut(s) 157, 388
Fnu4HI GCNGC 1 cut(s) 531
FokI GGATG 1 cut(s) 17
FriOI GRGCYC 1 cut(s) 143
Fsp4HI GCNGC 1 cut(s) 531
FspBI CTAG 1 cut(s) 583
GluI GCNGC 1 cut(s) 531
GsuI CTGGAG 1 cut(s) 165
HaeIII GGCC 2 cut(s) 480, 551
Hin1II CATG 2 cut(s) 161, 392
HphI GGTGA 7 cut(s) 80, 191, 228, 311, 353, 370, 433
Hpy188I TCNGA 2 cut(s) 25, 318
Hpy188III TCNNGA 2 cut(s) 144, 521
HpyAV CCTTC 7 cut(s) 57, 80, 167, 182, 404, 412, 458
HpyCH4V TGCA 2 cut(s) 392, 530
HpyF3I CTNAG 1 cut(s) 267
Hsp92II CATG 2 cut(s) 161, 392
LmnI GCTCC 2 cut(s) 146, 538
LpnPI CCDG 5 cut(s) 129, 134, 240, 282, 534
Lsp1109I GCAGC 1 cut(s) 542
LweI GCATC 1 cut(s) 517
MaeI CTAG 1 cut(s) 583
MaeIII GTNAC 2 cut(s) 234, 262
MboII GAAGA 5 cut(s) 164, 194, 293, 413, 460
MhlI GDGCHC 1 cut(s) 143
MluCI AATT 1 cut(s) 516
MmeI TCCRAC 3 cut(s) 249, 402, 560
MseI TTAA 1 cut(s) 309
MslI CAYNNNNRTG 1 cut(s) 393
NlaIII CATG 2 cut(s) 161, 392
NmuCI GTSAC 1 cut(s) 234
PceI AGGCCT 2 cut(s) 480, 551
PkrI GCNGC 1 cut(s) 532
PsiI TTATAA 1 cut(s) 209
Psp124BI GAGCTC 1 cut(s) 143
RsaI GTAC 1 cut(s) 247
RsaNI GTAC 1 cut(s) 246
RseI CAYNNNNRTG 1 cut(s) 393
SacI GAGCTC 1 cut(s) 143
SaqAI TTAA 1 cut(s) 309
SatI GCNGC 1 cut(s) 531
ScaI AGTACT 1 cut(s) 247
SduI GDGCHC 1 cut(s) 143
SfaNI GCATC 1 cut(s) 517
SmiMI CAYNNNNRTG 1 cut(s) 393
Sse9I AATT 1 cut(s) 516
SseBI AGGCCT 2 cut(s) 480, 551
SspMI CTAG 1 cut(s) 583
SstI GAGCTC 1 cut(s) 143
StuI AGGCCT 2 cut(s) 480, 551
StyI CCWWGG 1 cut(s) 239
TasI AATT 1 cut(s) 516
TatI WGTACW 1 cut(s) 245
Tru1I TTAA 1 cut(s) 309
Tru9I TTAA 1 cut(s) 309
TseFI GTSAC 1 cut(s) 234
TseI GCWGC 1 cut(s) 530
Tsp45I GTSAC 1 cut(s) 234
TspDTI ATGAA 6 cut(s) 87, 100, 201, 208, 300, 377
XspI CTAG 1 cut(s) 583
ZrmI AGTACT 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.