Rmu_co8431547.1_g000001

BTB POZ domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8431547.1
Physical Location & Seq
Reverse (-)
127 .. 1500
1374 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8431547.1_g000001.1.cds

Sequence Viewer

Length: 438 bp
gccgtcaaggcttggagcgagcagccgtcgtttactgcggatttgcagagggcgtttcgtgacgatgcgtggaggaatatagtgcctggcctgcctggtgtgttgctccgctgcactgccaagctttcgagtgcaattgcttccggtaccattttggttgctgctcaggttaggaagaagcttgtaaatgattggcttccggttctgattgtatgcaaagacaatacatcacctctgacgccaaataacagacccttatacctggacctggaagagacattcctcaaaataatctctacactgccgatgttagatgcaaaagagttgttgcagcagtgccttgtcttctcaacccgaaattttgatgattgccctcatttggtcatggctttcaacacctggttccgccgtgctgctcgaccccctcaaggaatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

145

Amino Acids

16.29

Weight (kDa)

9.07

Isoelectric Point (pI)

49.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 146
AccB1I GGYRCC 1 cut(s) 146
AciI CCGC 3 cut(s) 38, 109, 406
AcsI RAATTY 1 cut(s) 358
AcyI GRCGYC 1 cut(s) 239
AfaI GTAC 1 cut(s) 148
AfiI CCNNNNNNNGG 3 cut(s) 268, 379, 428
AgsI TTSAA 1 cut(s) 394
AjnI CCWGG 5 cut(s) 85, 94, 261, 267, 398
AluBI AGCT 2 cut(s) 124, 181
AluI AGCT 2 cut(s) 124, 181
Alw26I GTCTC 1 cut(s) 269
AoxI GGCC 1 cut(s) 88
ApeKI GCWGC 5 cut(s) 22, 111, 161, 331, 413
ApoI RAATTY 1 cut(s) 358
Asp718I GGTACC 1 cut(s) 146
AspS9I GGNCC 1 cut(s) 265
AsuHPI GGTGA 1 cut(s) 222
AvaII GGWCC 1 cut(s) 265
BanI GGYRCC 1 cut(s) 146
BbsI GAAGAC 1 cut(s) 337
BbvI GCAGC 5 cut(s) 34, 98, 148, 343, 400
BceAI ACGGC 2 cut(s) 10, 393
BciT130I CCWGG 5 cut(s) 87, 96, 263, 269, 400
BcoDI GTCTC 1 cut(s) 269
BfaI CTAG 1 cut(s) 436
BglI GCCNNNNNGGC 1 cut(s) 8
BisI GCNGC 5 cut(s) 23, 112, 162, 332, 414
BlsI GCNGC 5 cut(s) 24, 113, 163, 333, 415
Bme1390I CCNGG 5 cut(s) 87, 96, 263, 269, 400
Bme18I GGWCC 1 cut(s) 265
BmgT120I GGNCC 1 cut(s) 265
BmiI GGNNCC 2 cut(s) 148, 404
BmrFI CCNGG 5 cut(s) 87, 96, 263, 269, 400
BmsI GCATC 2 cut(s) 55, 304
BpiI GAAGAC 1 cut(s) 337
Bpu10I CCTNAGC 1 cut(s) 165
BpuEI CTTGAG 1 cut(s) 411
BsaHI GRCGYC 1 cut(s) 239
BsaWI WCCGGW 2 cut(s) 143, 199
Bsc4I CCNNNNNNNGG 3 cut(s) 268, 379, 428
BseBI CCWGG 5 cut(s) 87, 96, 263, 269, 400
BseLI CCNNNNNNNGG 3 cut(s) 268, 379, 428
BseMII CTCAG 1 cut(s) 179
BseXI GCAGC 5 cut(s) 34, 98, 148, 343, 400
BsgI GTGCAG 1 cut(s) 97
BshFI GGCC 1 cut(s) 90
BshNI GGYRCC 1 cut(s) 146
BsiSI CCGG 2 cut(s) 144, 200
BslI CCNNNNNNNGG 3 cut(s) 268, 379, 428
BsmAI GTCTC 1 cut(s) 269
BsnI GGCC 1 cut(s) 90
BspACI CCGC 3 cut(s) 38, 109, 406
BspANI GGCC 1 cut(s) 90
BspCNI CTCAG 1 cut(s) 178
BspLI GGNNCC 2 cut(s) 148, 404
BspT107I GGYRCC 1 cut(s) 146
BssNI GRCGYC 1 cut(s) 239
Bst2UI CCWGG 5 cut(s) 87, 96, 263, 269, 400
Bst6I CTCTTC 1 cut(s) 267
BstACI GRCGYC 1 cut(s) 239
BstC8I GCNNGC 2 cut(s) 20, 92
BstDEI CTNAG 1 cut(s) 165
BstMAI GTCTC 1 cut(s) 269
BstMWI GCNNNNNNNGC 2 cut(s) 8, 91
BstNI CCWGG 5 cut(s) 87, 96, 263, 269, 400
BstSCI CCNGG 5 cut(s) 85, 94, 261, 267, 398
BstV1I GCAGC 5 cut(s) 34, 98, 148, 343, 400
BstV2I GAAGAC 1 cut(s) 337
BsuRI GGCC 1 cut(s) 90
BtsI GCAGTG 3 cut(s) 114, 299, 341
BtsIMutI CAGTG 3 cut(s) 114, 299, 341
Cac8I GCNNGC 2 cut(s) 20, 92
Cfr13I GGNCC 1 cut(s) 265
CseI GACGC 1 cut(s) 247
CsiI ACCWGGT 1 cut(s) 398
Csp6I GTAC 1 cut(s) 147
CviAII CATG 1 cut(s) 385
CviJI RGCY 7 cut(s) 11, 25, 90, 124, 181, 196, 389
CviKI_1 RGCY 7 cut(s) 11, 25, 90, 124, 181, 196, 389
CviQI GTAC 1 cut(s) 147
DdeI CTNAG 1 cut(s) 165
Eam1104I CTCTTC 1 cut(s) 267
EarI CTCTTC 1 cut(s) 267
EciI GGCGGA 1 cut(s) 395
Eco47I GGWCC 1 cut(s) 265
EcoRII CCWGG 5 cut(s) 85, 94, 261, 267, 398
FaeI CATG 1 cut(s) 388
FaiI YATR 4 cut(s) 80, 214, 259, 386
FatI CATG 1 cut(s) 384
Fnu4HI GCNGC 5 cut(s) 23, 112, 162, 332, 414
Fsp4HI GCNGC 5 cut(s) 23, 112, 162, 332, 414
FspBI CTAG 1 cut(s) 436
GluI GCNGC 5 cut(s) 23, 112, 162, 332, 414
HaeIII GGCC 1 cut(s) 90
HapII CCGG 2 cut(s) 144, 200
HgaI GACGC 1 cut(s) 247
Hin1I GRCGYC 1 cut(s) 239
Hin1II CATG 1 cut(s) 388
HindIII AAGCTT 2 cut(s) 122, 179
HinfI GANTC 1 cut(s) 432
HpaII CCGG 2 cut(s) 144, 200
HphI GGTGA 1 cut(s) 222
Hpy166II GTNNAC 1 cut(s) 33
Hpy188I TCNGA 2 cut(s) 207, 237
Hpy188III TCNNGA 1 cut(s) 59
Hpy8I GTNNAC 1 cut(s) 33
Hpy99I CGWCG 1 cut(s) 31
HpyCH4V TGCA 6 cut(s) 46, 114, 134, 216, 317, 331
HpyF10VI GCNNNNNNNGC 2 cut(s) 8, 91
HpyF3I CTNAG 1 cut(s) 165
Hsp92I GRCGYC 1 cut(s) 239
Hsp92II CATG 1 cut(s) 388
KpnI GGTACC 1 cut(s) 150
LmnI GCTCC 2 cut(s) 15, 111
Lsp1109I GCAGC 5 cut(s) 34, 98, 148, 343, 400
LweI GCATC 2 cut(s) 55, 304
MabI ACCWGGT 1 cut(s) 398
MaeI CTAG 1 cut(s) 436
MaeIII GTNAC 1 cut(s) 59
MboII GAAGA 3 cut(s) 187, 284, 337
MfeI CAATTG 1 cut(s) 135
MluCI AATT 2 cut(s) 135, 358
MnlI CCTC 6 cut(s) 42, 66, 243, 293, 384, 435
MspA1I CMGCKG 1 cut(s) 111
MspI CCGG 2 cut(s) 144, 200
MspR9I CCNGG 5 cut(s) 87, 96, 263, 269, 400
MunI CAATTG 1 cut(s) 135
MvaI CCWGG 5 cut(s) 87, 96, 263, 269, 400
MwoI GCNNNNNNNGC 2 cut(s) 8, 91
NlaIII CATG 1 cut(s) 388
NlaIV GGNNCC 2 cut(s) 148, 404
NmuCI GTSAC 1 cut(s) 59
PfeI GAWTC 1 cut(s) 432
PkrI GCNGC 5 cut(s) 24, 113, 163, 333, 415
Psp6I CCWGG 5 cut(s) 85, 94, 261, 267, 398
PspGI CCWGG 5 cut(s) 85, 94, 261, 267, 398
PspN4I GGNNCC 2 cut(s) 148, 404
PspPI GGNCC 1 cut(s) 265
RsaI GTAC 1 cut(s) 148
RsaNI GTAC 1 cut(s) 147
SatI GCNGC 5 cut(s) 23, 112, 162, 332, 414
Sau96I GGNCC 1 cut(s) 265
ScrFI CCNGG 5 cut(s) 87, 96, 263, 269, 400
SetI ASST 7 cut(s) 126, 171, 183, 235, 264, 270, 401
SexAI ACCWGGT 1 cut(s) 398
SfaNI GCATC 2 cut(s) 55, 304
SinI GGWCC 1 cut(s) 265
SmlI CTYRAG 1 cut(s) 426
SmoI CTYRAG 1 cut(s) 426
Sse9I AATT 2 cut(s) 135, 358
SsiI CCGC 3 cut(s) 38, 109, 406
SspMI CTAG 1 cut(s) 436
StyD4I CCNGG 5 cut(s) 85, 94, 261, 267, 398
TaqI TCGA 2 cut(s) 128, 418
TasI AATT 2 cut(s) 135, 358
TfiI GAWTC 1 cut(s) 432
TscAI CASTG 3 cut(s) 121, 306, 341
TseFI GTSAC 1 cut(s) 59
TseI GCWGC 5 cut(s) 22, 111, 161, 331, 413
Tsp45I GTSAC 1 cut(s) 59
TspRI CASTG 3 cut(s) 121, 306, 341
VpaK11BI GGWCC 1 cut(s) 265
XapI RAATTY 1 cut(s) 358
XspI CTAG 1 cut(s) 436
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.