Rmu_co8442071.1_g000001

Leucine-zipper of ternary complex factor MIP1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8442071.1
Physical Location & Seq
Reverse (-)
1 .. 1285
1285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8442071.1_g000001.1.cds

Sequence Viewer

Length: 732 bp
atggcattgaagagggaagatttagcagttcaatctggtagtcagtcgcttgtaaattcatggaaggaatatgttggagaagaagagaggccattagattctagtgttaaccgttgccactcctcactttcacaacattctgcattcgtaactagaacctctcctccagaagagtcattggcgaaagctttgcgtgcctgtcattctcaaccattgtccatgatggagtatgctcagaatacttcatcaaatgtaattagtctggcagagcatctcggtacacgcatttccgatcatattcaagagacgcctaacaggctttcggaggacatgatcaagtgcatgtccactatatattgcaagcttgcggaacccccctcaacacagaatggactttcatctcccaattcatctctgtcatcaacgagtgccttttctccacacgaacagagtgaaatgtggagtccgcagttcaaaaataatttatcttttgatgtacgattggataatccgtttctggtggaaggactcaaggaatttagtgggccatacagcacaatggttgaagtgccatggatatatagagatactaaaaaattaggtgatattgaacacttgctacaacatttcaggtcacttatcagtcgtttagaggaagtagatcctagaaagttgaataatgatgagaaattagcgttctggattaatgtacacaatactttggtcatgcat
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

244

Amino Acids

27.65

Weight (kDa)

5.68

Isoelectric Point (pI)

61.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 368, 467
AclWI GGATC 1 cut(s) 656
AcsI RAATTY 2 cut(s) 55, 536
AcyI GRCGYC 1 cut(s) 308
AfaI GTAC 3 cut(s) 280, 498, 711
AgsI TTSAA 7 cut(s) 10, 32, 302, 475, 566, 611, 676
AloI GAACNNNNNNTCC 2 cut(s) 148, 180
AluBI AGCT 2 cut(s) 188, 364
AluI AGCT 2 cut(s) 188, 364
Alw26I GTCTC 1 cut(s) 299
AlwI GGATC 1 cut(s) 656
AoxI GGCC 2 cut(s) 89, 545
ApoI RAATTY 2 cut(s) 55, 536
AseI ATTAAT 1 cut(s) 705
AspS9I GGNCC 1 cut(s) 545
AsuHPI GGTGA 1 cut(s) 614
BccI CCATC 1 cut(s) 217
BcgI CGANNNNNNTGC 2 cut(s) 172, 206
BclI TGATCA 1 cut(s) 333
BcoDI GTCTC 1 cut(s) 299
BfaI CTAG 3 cut(s) 102, 153, 666
BglI GCCNNNNNGGC 1 cut(s) 316
BmgT120I GGNCC 1 cut(s) 545
BmiI GGNNCC 1 cut(s) 372
BmsI GCATC 1 cut(s) 280
BpmI CTGGAG 1 cut(s) 150
BpuEI CTTGAG 1 cut(s) 515
BsaHI GRCGYC 1 cut(s) 308
BsaJI CCNNGG 1 cut(s) 572
BsaXI ACNNNNNCTCC 2 cut(s) 148, 178
BseDI CCNNGG 1 cut(s) 572
BseMII CTCAG 1 cut(s) 248
BseRI GAGGAG 2 cut(s) 112, 153
BshFI GGCC 2 cut(s) 91, 547
BsmAI GTCTC 1 cut(s) 299
BsmBI CGTCTC 1 cut(s) 299
BsmI GAATGC 1 cut(s) 143
BsnI GGCC 2 cut(s) 91, 547
Bsp1407I TGTACA 1 cut(s) 709
Bsp143I GATC 3 cut(s) 292, 333, 661
Bsp19I CCATGG 1 cut(s) 572
BspACI CCGC 2 cut(s) 368, 467
BspANI GGCC 2 cut(s) 91, 547
BspCNI CTCAG 1 cut(s) 247
BspLI GGNNCC 1 cut(s) 372
BspPI GGATC 1 cut(s) 656
BsrGI TGTACA 1 cut(s) 709
BssECI CCNNGG 1 cut(s) 572
BssMI GATC 3 cut(s) 292, 333, 661
BssNI GRCGYC 1 cut(s) 308
BssT1I CCWWGG 1 cut(s) 572
Bst4CI ACNGT 1 cut(s) 113
Bst6I CTCTTC 3 cut(s) 5, 78, 165
BstACI GRCGYC 1 cut(s) 308
BstAUI TGTACA 1 cut(s) 709
BstC8I GCNNGC 3 cut(s) 195, 362, 366
BstDEI CTNAG 1 cut(s) 234
BstDSI CCRYGG 1 cut(s) 572
BstKTI GATC 3 cut(s) 295, 336, 664
BstMAI GTCTC 1 cut(s) 299
BstMBI GATC 3 cut(s) 292, 333, 661
BstMWI GCNNNNNNNGC 2 cut(s) 194, 316
BstNSI RCATGY 1 cut(s) 346
BstX2I RGATCY 1 cut(s) 661
BstYI RGATCY 1 cut(s) 661
BsuRI GGCC 2 cut(s) 91, 547
BtgI CCRYGG 1 cut(s) 572
Cac8I GCNNGC 3 cut(s) 195, 362, 366
Cfr13I GGNCC 1 cut(s) 545
CseI GACGC 1 cut(s) 316
Csp6I GTAC 3 cut(s) 279, 497, 710
CviAII CATG 6 cut(s) 60, 220, 331, 343, 573, 727
CviJI RGCY 5 cut(s) 91, 188, 319, 364, 547
CviKI_1 RGCY 5 cut(s) 91, 188, 319, 364, 547
CviQI GTAC 3 cut(s) 279, 497, 710
DdeI CTNAG 1 cut(s) 234
DpnI GATC 3 cut(s) 294, 335, 663
DpnII GATC 3 cut(s) 292, 333, 661
Eam1104I CTCTTC 3 cut(s) 5, 78, 165
EarI CTCTTC 3 cut(s) 5, 78, 165
Eco130I CCWWGG 1 cut(s) 572
EcoT14I CCWWGG 1 cut(s) 572
EcoT22I ATGCAT 1 cut(s) 732
ErhI CCWWGG 1 cut(s) 572
Esp3I CGTCTC 1 cut(s) 299
FaeI CATG 6 cut(s) 63, 223, 334, 346, 576, 730
FatI CATG 6 cut(s) 59, 219, 330, 342, 572, 726
FbaI TGATCA 1 cut(s) 333
FspBI CTAG 3 cut(s) 102, 153, 666
GsuI CTGGAG 1 cut(s) 150
HaeIII GGCC 2 cut(s) 91, 547
HgaI GACGC 1 cut(s) 316
Hin1I GRCGYC 1 cut(s) 308
Hin1II CATG 6 cut(s) 63, 223, 334, 346, 576, 730
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
HindIII AAGCTT 2 cut(s) 186, 362
HinfI GANTC 4 cut(s) 98, 173, 463, 528
HpaI GTTAAC 1 cut(s) 109
HphI GGTGA 1 cut(s) 614
Hpy166II GTNNAC 4 cut(s) 109, 281, 348, 712
Hpy188I TCNGA 3 cut(s) 237, 292, 325
Hpy188III TCNNGA 3 cut(s) 167, 302, 700
Hpy8I GTNNAC 4 cut(s) 109, 281, 348, 712
HpyAV CCTTC 2 cut(s) 58, 518
HpyCH4III ACNGT 1 cut(s) 113
HpyCH4V TGCA 4 cut(s) 143, 342, 360, 730
HpyF10VI GCNNNNNNNGC 2 cut(s) 194, 316
HpyF3I CTNAG 1 cut(s) 234
Hsp92I GRCGYC 1 cut(s) 308
Hsp92II CATG 6 cut(s) 63, 223, 334, 346, 576, 730
Ksp22I TGATCA 1 cut(s) 333
KspAI GTTAAC 1 cut(s) 109
Kzo9I GATC 3 cut(s) 292, 333, 661
LpnPI CCDG 8 cut(s) 21, 180, 211, 248, 301, 503, 616, 685
LweI GCATC 1 cut(s) 280
MaeI CTAG 3 cut(s) 102, 153, 666
MaeIII GTNAC 2 cut(s) 148, 633
MalI GATC 3 cut(s) 294, 335, 663
MboI GATC 3 cut(s) 292, 333, 661
MboII GAAGA 5 cut(s) 22, 29, 92, 95, 182
MflI RGATCY 1 cut(s) 661
MluCI AATT 7 cut(s) 55, 255, 406, 481, 536, 596, 689
MlyI GAGTC 3 cut(s) 182, 472, 522
MmeI TCCRAC 1 cut(s) 55
MnlI CCTC 8 cut(s) 6, 81, 133, 169, 174, 319, 388, 646
Mph1103I ATGCAT 1 cut(s) 732
MseI TTAA 2 cut(s) 108, 705
Mva1269I GAATGC 1 cut(s) 143
MwoI GCNNNNNNNGC 2 cut(s) 194, 316
NcoI CCATGG 1 cut(s) 572
NdeII GATC 3 cut(s) 292, 333, 661
NlaIII CATG 6 cut(s) 63, 223, 334, 346, 576, 730
NlaIV GGNNCC 1 cut(s) 372
NmuCI GTSAC 1 cut(s) 633
NsiI ATGCAT 1 cut(s) 732
NspI RCATGY 1 cut(s) 346
PctI GAATGC 1 cut(s) 143
PfeI GAWTC 1 cut(s) 98
PleI GAGTC 3 cut(s) 181, 471, 522
PpsI GAGTC 3 cut(s) 181, 471, 522
PshBI ATTAAT 1 cut(s) 705
PspN4I GGNNCC 1 cut(s) 372
PspPI GGNCC 1 cut(s) 545
PsrI GAACNNNNNNTAC 2 cut(s) 603, 635
PsuI RGATCY 1 cut(s) 661
RsaI GTAC 3 cut(s) 280, 498, 711
RsaNI GTAC 3 cut(s) 279, 497, 710
SaqAI TTAA 2 cut(s) 108, 705
Sau3AI GATC 3 cut(s) 292, 333, 661
Sau96I GGNCC 1 cut(s) 545
SchI GAGTC 3 cut(s) 182, 472, 522
SetI ASST 5 cut(s) 161, 190, 366, 604, 635
SfaNI GCATC 1 cut(s) 280
SmlI CTYRAG 1 cut(s) 530
SmoI CTYRAG 1 cut(s) 530
Sse9I AATT 7 cut(s) 55, 255, 406, 481, 536, 596, 689
SsiI CCGC 2 cut(s) 368, 467
SspMI CTAG 3 cut(s) 102, 153, 666
StyI CCWWGG 1 cut(s) 572
TaaI ACNGT 1 cut(s) 113
TasI AATT 7 cut(s) 55, 255, 406, 481, 536, 596, 689
TatI WGTACW 1 cut(s) 709
TfiI GAWTC 1 cut(s) 98
Tru1I TTAA 2 cut(s) 108, 705
Tru9I TTAA 2 cut(s) 108, 705
TseFI GTSAC 1 cut(s) 633
Tsp45I GTSAC 1 cut(s) 633
TspDTI ATGAA 4 cut(s) 48, 234, 387, 399
TspGWI ACGGA 1 cut(s) 501
VspI ATTAAT 1 cut(s) 705
XapI RAATTY 2 cut(s) 55, 536
XceI RCATGY 1 cut(s) 346
XspI CTAG 3 cut(s) 102, 153, 666
Zsp2I ATGCAT 1 cut(s) 732
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.