Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8457165.1

Orthogroup ID

OG0006604

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1742

Gene Structure 1742 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8457165.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 638 bp

atgtccctctggctcttactcctatggatggtcaccattcctctccaagccaactctcaaagtaaccctagaggttacctcctaaactgtggcgctggggcctcatccaataatgatgtgatcgtaggtagcctgaagtatgtcacagatgaaggttacatatcagttggaaaaacgagcaacatcaagcagaaagacttggttcccatactcactacattgcgctattttccagacaagtctgcgcgaaaatattgttatgaatttccagtgatcaaagatggaaagtaccttgtgaggacgacttactattatggtggttttgatggtgggaaggagccaccggtgtttgaccaaattgtggatgggactaagtggagtgtagttaacacaacagaggactttgccaatggacttagctcgtattatgagatagtggtgtcggcaaaggggaaggaactaagtgtgtgtcttgctaggaataacatgacggggactgattctagtcccttcatctcagctcttgagctggagtacttggatgactcggtgtataactccaccgattttaacaagtatggacttagtactgtggcaagggcaaacttcggaactcctactaatggtgacgtaattgg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_4 LRR_8 Malectin_like

Protein Analysis

213

Amino Acids

23.47

Weight (kDa)

5.03

Isoelectric Point (pI)

30.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006604)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G19230
fragaria_vesca	FvH4_2g06120 FvH4_2g06120 FvH4_2g06120 FvH4_2g06120 FvH4_2g06120 FvH4_2g06120 FvH4_2g06120 FvH4_2g06120 FvH4_2g06120 FvH4_2g06120 FvH4_2g06120
malus_domestica	MD05G1080300.v1.1
prunus_persica	Prupe.8G124100_v2.0.a1
pyrus_communis	pycom05g07330
rosa_chinensis	RchiOBHm_Chr6g0257071
rosa_laevigata	RLG00000014675
rosa_multiflora	Rmu_co8457165.1_g000001 Rmu_sc0000659.1_g000006
rosa_roxburghii	Rroxscaffold_7G00208490
rosa_rugosa	Rorug05G0575400
rosa_samantha	Rh6AG093400 Rh6BG084200 Rh6CG080800 Rh6DG076200
rosa_wichuraiana	Rw6G008030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	361
AccII	CGCG	1 cut(s)	247
AcsI	RAATTY	1 cut(s)	263
AcuI	CTGAAG	1 cut(s)	155
AfaI	GTAC	3 cut(s)	290, 536, 589
AfiI	CCNNNNNNNGG	3 cut(s)	28, 361, 623
AgeI	ACCGGT	1 cut(s)	343
AluBI	AGCT	3 cut(s)	420, 521, 529
AluI	AGCT	3 cut(s)	420, 521, 529
AoxI	GGCC	1 cut(s)	99
ApoI	RAATTY	1 cut(s)	263
AsiGI	ACCGGT	1 cut(s)	343
AspLEI	GCGC	3 cut(s)	95, 225, 247
AspS9I	GGNCC	1 cut(s)	99
AsuHPI	GGTGA	2 cut(s)	25, 638
BccI	CCATC	4 cut(s)	22, 275, 320, 359
BclI	TGATCA	1 cut(s)	273
BfaI	CTAG	3 cut(s)	69, 477, 504
BfoI	RGCGCY	1 cut(s)	96
BmcAI	AGTACT	2 cut(s)	536, 589
BmgT120I	GGNCC	1 cut(s)	99
BmiI	GGNNCC	3 cut(s)	100, 204, 339
BplI	GAGNNNNNCTC	2 cut(s)	63, 95
BpmI	CTGGAG	1 cut(s)	551
BpuEI	CTTGAG	1 cut(s)	545
BsaWI	WCCGGW	1 cut(s)	343
Bsc4I	CCNNNNNNNGG	3 cut(s)	28, 361, 623
Bse118I	RCCGGY	1 cut(s)	343
Bse1I	ACTGG	1 cut(s)	269
Bse3DI	GCAATG	1 cut(s)	218
BseGI	GGATG	4 cut(s)	33, 104, 370, 547
BseLI	CCNNNNNNNGG	3 cut(s)	28, 361, 623
BseMI	GCAATG	1 cut(s)	218
BseMII	CTCAG	1 cut(s)	531
BseNI	ACTGG	1 cut(s)	269
BseYI	CCCAGC	1 cut(s)	95
Bsh1236I	CGCG	1 cut(s)	247
BshFI	GGCC	1 cut(s)	101
BshTI	ACCGGT	1 cut(s)	343
BsiSI	CCGG	1 cut(s)	344
BslFI	GGGAC	3 cut(s)	382, 492, 508
BslI	CCNNNNNNNGG	3 cut(s)	28, 361, 623
BsmFI	GGGAC	3 cut(s)	382, 492, 508
BsnI	GGCC	1 cut(s)	101
Bsp143I	GATC	2 cut(s)	120, 273
BspANI	GGCC	1 cut(s)	101
BspCNI	CTCAG	1 cut(s)	530
BspFNI	CGCG	1 cut(s)	247
BspLI	GGNNCC	3 cut(s)	100, 204, 339
BsrDI	GCAATG	1 cut(s)	218
BsrFI	RCCGGY	1 cut(s)	343
BsrI	ACTGG	1 cut(s)	269
BssAI	RCCGGY	1 cut(s)	343
BssMI	GATC	2 cut(s)	120, 273
Bst4CI	ACNGT	2 cut(s)	89, 592
BstDEI	CTNAG	5 cut(s)	372, 416, 461, 517, 584
BstEII	GGTNACC	2 cut(s)	31, 74
BstF5I	GGATG	4 cut(s)	33, 104, 370, 547
BstFNI	CGCG	1 cut(s)	247
BstH2I	RGCGCY	1 cut(s)	96
BstHHI	GCGC	3 cut(s)	95, 225, 247
BstKTI	GATC	2 cut(s)	123, 276
BstMBI	GATC	2 cut(s)	120, 273
BstPI	GGTNACC	2 cut(s)	31, 74
BstUI	CGCG	1 cut(s)	247
BsuRI	GGCC	1 cut(s)	101
BtsCI	GGATG	4 cut(s)	33, 104, 370, 547
BtsIMutI	CAGTG	1 cut(s)	276
CfoI	GCGC	3 cut(s)	95, 225, 247
Cfr10I	RCCGGY	1 cut(s)	343
Cfr13I	GGNCC	1 cut(s)	99
Csp6I	GTAC	3 cut(s)	289, 535, 588
CspAI	ACCGGT	1 cut(s)	343
CviAII	CATG	1 cut(s)	487
CviJI	RGCY	8 cut(s)	13, 50, 101, 132, 340, 420, 521, 529
CviKI_1	RGCY	8 cut(s)	13, 50, 101, 132, 340, 420, 521, 529
CviQI	GTAC	3 cut(s)	289, 535, 588
DdeI	CTNAG	5 cut(s)	372, 416, 461, 517, 584
DpnI	GATC	2 cut(s)	122, 275
DpnII	GATC	2 cut(s)	120, 273
Eco57I	CTGAAG	1 cut(s)	155
Eco91I	GGTNACC	2 cut(s)	31, 74
EcoO109I	RGGNCCY	1 cut(s)	99
EcoO65I	GGTNACC	2 cut(s)	31, 74
FaeI	CATG	1 cut(s)	490
FaqI	GGGAC	3 cut(s)	382, 492, 508
FatI	CATG	1 cut(s)	486
FbaI	TGATCA	1 cut(s)	273
FokI	GGATG	4 cut(s)	40, 91, 377, 554
FspBI	CTAG	3 cut(s)	69, 477, 504
GlaI	GCGC	3 cut(s)	94, 224, 246
GsaI	CCCAGC	1 cut(s)	99
GsuI	CTGGAG	1 cut(s)	551
HaeII	RGCGCY	1 cut(s)	96
HaeIII	GGCC	1 cut(s)	101
HapII	CCGG	1 cut(s)	344
HhaI	GCGC	3 cut(s)	95, 225, 247
Hin1II	CATG	1 cut(s)	490
Hin6I	GCGC	3 cut(s)	93, 223, 245
HinP1I	GCGC	3 cut(s)	93, 223, 245
HincII	GTYRAC	1 cut(s)	388
HindII	GTYRAC	1 cut(s)	388
HinfI	GANTC	2 cut(s)	500, 545
HpaI	GTTAAC	1 cut(s)	388
HpaII	CCGG	1 cut(s)	344
HphI	GGTGA	2 cut(s)	25, 638
Hpy166II	GTNNAC	1 cut(s)	388
Hpy188I	TCNGA	1 cut(s)	611
Hpy188III	TCNNGA	2 cut(s)	233, 524
Hpy8I	GTNNAC	1 cut(s)	388
HpyAV	CCTTC	4 cut(s)	146, 328, 448, 520
HpyCH4III	ACNGT	2 cut(s)	89, 592
HpyCH4IV	ACGT	1 cut(s)	630
HpyF3I	CTNAG	5 cut(s)	372, 416, 461, 517, 584
HpySE526I	ACGT	1 cut(s)	630
Hsp92II	CATG	1 cut(s)	490
HspAI	GCGC	3 cut(s)	93, 223, 245
Ksp22I	TGATCA	1 cut(s)	273
KspAI	GTTAAC	1 cut(s)	388
Kzo9I	GATC	2 cut(s)	120, 273
LmnI	GCTCC	1 cut(s)	337
LpnPI	CCDG	6 cut(s)	81, 146, 246, 282, 357, 515
MaeI	CTAG	3 cut(s)	69, 477, 504
MaeII	ACGT	1 cut(s)	630
MaeIII	GTNAC	6 cut(s)	31, 62, 74, 142, 155, 626
MalI	GATC	2 cut(s)	122, 275
MboI	GATC	2 cut(s)	120, 273
MluCI	AATT	3 cut(s)	263, 357, 633
MlyI	GAGTC	1 cut(s)	539
MmeI	TCCRAC	1 cut(s)	148
MnlI	CCTC	7 cut(s)	17, 51, 65, 89, 112, 291, 391
MseI	TTAA	2 cut(s)	387, 570
MspI	CCGG	1 cut(s)	344
MvnI	CGCG	1 cut(s)	247
NdeII	GATC	2 cut(s)	120, 273
NlaIII	CATG	1 cut(s)	490
NlaIV	GGNNCC	3 cut(s)	100, 204, 339
NmuCI	GTSAC	3 cut(s)	31, 142, 626
PfeI	GAWTC	1 cut(s)	500
PflMI	CCANNNNNTGG	1 cut(s)	361
PinAI	ACCGGT	1 cut(s)	343
PleI	GAGTC	1 cut(s)	539
PpsI	GAGTC	1 cut(s)	539
PspEI	GGTNACC	2 cut(s)	31, 74
PspFI	CCCAGC	1 cut(s)	95
PspN4I	GGNNCC	3 cut(s)	100, 204, 339
PspPI	GGNCC	1 cut(s)	99
RsaI	GTAC	3 cut(s)	290, 536, 589
RsaNI	GTAC	3 cut(s)	289, 535, 588
SaqAI	TTAA	2 cut(s)	387, 570
Sau3AI	GATC	2 cut(s)	120, 273
Sau96I	GGNCC	1 cut(s)	99
ScaI	AGTACT	2 cut(s)	536, 589
SchI	GAGTC	1 cut(s)	539
SetI	ASST	9 cut(s)	76, 81, 130, 157, 294, 422, 523, 531, 633
SgrAI	CRCCGGYG	1 cut(s)	343
SmlI	CTYRAG	1 cut(s)	524
SmoI	CTYRAG	1 cut(s)	524
Sse9I	AATT	3 cut(s)	263, 357, 633
SspI	AATATT	1 cut(s)	254
SspMI	CTAG	3 cut(s)	69, 477, 504
TaaI	ACNGT	2 cut(s)	89, 592
TaiI	ACGT	1 cut(s)	633
TasI	AATT	3 cut(s)	263, 357, 633
TatI	WGTACW	2 cut(s)	534, 587
TfiI	GAWTC	1 cut(s)	500
Tru1I	TTAA	2 cut(s)	387, 570
Tru9I	TTAA	2 cut(s)	387, 570
TscAI	CASTG	1 cut(s)	276
TseFI	GTSAC	3 cut(s)	31, 142, 626
Tsp45I	GTSAC	3 cut(s)	31, 142, 626
TspDTI	ATGAA	3 cut(s)	165, 276, 502
TspRI	CASTG	1 cut(s)	276
Van91I	CCANNNNNTGG	1 cut(s)	361
XapI	RAATTY	1 cut(s)	263
XcmI	CCANNNNNNNNNTGG	1 cut(s)	362
XspI	CTAG	3 cut(s)	69, 477, 504
ZrmI	AGTACT	2 cut(s)	536, 589

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.