Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8461125.1

Orthogroup ID

OG0005307

Physical Location & Seq

Genomic Coordinates Reverse (-)

580 .. 1730

Gene Structure 1151 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8461125.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 768 bp

ctgagattacataacggcactgcactatcagccaaagagtgggctgatagcctaaccaacattagtgttggagatctcctttctggggtgcctcatgatctagatgctaactgcattgatcaacctcttgctggaaggtcccagtgtcttccgcagatcccatttagctgtgattcatttgatgctgcgattgctgctcatatttctagacagaagaacaagatgggatgtgagcctactatggtatcccatgtatcgtccatctgggatgctgaagaaacatgtgatgcctttgtgtttcaaaagaattcggctttccgtcaacagtctaccagttcatctggtgttgctcctccaggggactgcaaactgatggctagtacaagcttagtgggctgtgatcgtatggttgaggacttacctgcagtagagaggccaattaatgatcctcaacgagatcctatggatgagtgtcagtctgatccacatatcctagaaagttcagtgaaagatttcaacgctttagcagatatatactggcctgaatcattaggaccattagatttggagctaccatcatctaaataccataacgaagattttattctgaatgatagtctcagtgggctgaaccgccttattgccagcagtctggatgcatttcaaaattgctctttctttggttcaaacaagaaagaaccaacgccatcagttgaggctcgagaaactatttccttctcagattttaaaattggcaatggagtttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003682 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

255

Amino Acids

27.74

Weight (kDa)

4.53

Isoelectric Point (pI)

53.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005307)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G36960 AT2G36960 AT2G36960
fragaria_vesca	FvH4_6g16260 FvH4_6g16260 FvH4_6g16260 FvH4_6g16260 FvH4_6g16260 FvH4_6g16260
malus_domestica	MD12G1113900.v1.1
prunus_persica	Prupe.6G232900_v2.0.a1
pyrus_communis	pycom12g11300 pycom12g11310
rosa_chinensis	RchiOBHm_Chr3g0470121
rosa_laevigata	RLG00000024295
rosa_multiflora	Rmu_co8461125.1_g000001 Rmu_sc0005600.1_g000013
rosa_roxburghii	Rroxscaffold_6G00411160
rosa_rugosa	Rorug03G0106900 Rorug03G0107000 Rorug03G0107000 Rorug03G0107100
rosa_samantha	Rh3AG156300 Rh3BG180300 Rh3CG171100 Rh3DG194700
rosa_wichuraiana	Rw3G014710 Rw3G014780 Rw3G014800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	430
AccB1I	GGYRCC	1 cut(s)	88
AccB7I	CCANNNNNTGG	1 cut(s)	39
AccI	GTMKAC	1 cut(s)	329
AciI	CCGC	2 cut(s)	152, 634
AclWI	GGATC	4 cut(s)	151, 440, 452, 476
AcsI	RAATTY	1 cut(s)	307
AcuI	CTGAAG	1 cut(s)	294
AfaI	GTAC	1 cut(s)	382
AfiI	CCNNNNNNNGG	3 cut(s)	39, 85, 131
AflIII	ACRYGT	1 cut(s)	281
AgsI	TTSAA	4 cut(s)	302, 517, 665, 687
AjnI	CCWGG	1 cut(s)	355
AluBI	AGCT	3 cut(s)	168, 387, 571
AluI	AGCT	3 cut(s)	168, 387, 571
Alw26I	GTCTC	1 cut(s)	623
AlwI	GGATC	4 cut(s)	151, 440, 452, 476
Ama87I	CYCGRG	1 cut(s)	720
AoxI	GGCC	2 cut(s)	434, 539
ApeKI	GCWGC	2 cut(s)	185, 194
ApoI	RAATTY	1 cut(s)	307
AseI	ATTAAT	1 cut(s)	441
Asp700I	GAANNNNTTC	1 cut(s)	512
AspS9I	GGNCC	2 cut(s)	138, 554
AvaI	CYCGRG	1 cut(s)	720
AvaII	GGWCC	2 cut(s)	138, 554
BaeI	ACNNNNGTAYC	2 cut(s)	228, 261
BanI	GGYRCC	1 cut(s)	88
BbsI	GAAGAC	1 cut(s)	140
BbvI	GCAGC	2 cut(s)	172, 181
BccI	CCATC	5 cut(s)	217, 269, 367, 583, 715
BceAI	ACGGC	1 cut(s)	31
BciT130I	CCWGG	1 cut(s)	357
BciVI	GTATCC	1 cut(s)	256
BclI	TGATCA	1 cut(s)	118
BcoDI	GTCTC	1 cut(s)	623
BfaI	CTAG	4 cut(s)	101, 207, 378, 494
BfmI	CTRYAG	1 cut(s)	423
BfuAI	ACCTGC	1 cut(s)	430
BfuI	GTATCC	1 cut(s)	256
BglII	AGATCT	1 cut(s)	73
BisI	GCNGC	2 cut(s)	186, 195
BlsI	GCNGC	2 cut(s)	187, 196
Bme1390I	CCNGG	1 cut(s)	357
Bme18I	GGWCC	2 cut(s)	138, 554
BmeT110I	CYCGRG	1 cut(s)	720
BmgT120I	GGNCC	2 cut(s)	138, 554
BmiI	GGNNCC	2 cut(s)	90, 140
BmrFI	CCNGG	1 cut(s)	357
BmrI	ACTGGG	1 cut(s)	136
BmsI	GCATC	5 cut(s)	94, 172, 259, 277, 646
BmuI	ACTGGG	1 cut(s)	136
BpiI	GAAGAC	1 cut(s)	140
BpmI	CTGGAG	1 cut(s)	339
BsaJI	CCNNGG	1 cut(s)	356
Bsc4I	CCNNNNNNNGG	3 cut(s)	39, 85, 131
Bse1I	ACTGG	3 cut(s)	142, 333, 542
Bse3DI	GCAATG	1 cut(s)	763
BseBI	CCWGG	1 cut(s)	357
BseDI	CCNNGG	1 cut(s)	356
BseGI	GGATG	4 cut(s)	233, 274, 472, 661
BseLI	CCNNNNNNNGG	3 cut(s)	39, 85, 131
BseMI	GCAATG	1 cut(s)	763
BseMII	CTCAG	2 cut(s)	634, 753
BseNI	ACTGG	3 cut(s)	142, 333, 542
BseRI	GAGGAG	1 cut(s)	342
BseXI	GCAGC	2 cut(s)	172, 181
BsgI	GTGCAG	1 cut(s)	6
BshFI	GGCC	2 cut(s)	436, 541
BshNI	GGYRCC	1 cut(s)	88
BsiHKCI	CYCGRG	1 cut(s)	720
BslFI	GGGAC	2 cut(s)	124, 374
BslI	CCNNNNNNNGG	3 cut(s)	39, 85, 131
BsmAI	GTCTC	1 cut(s)	623
BsmFI	GGGAC	2 cut(s)	124, 374
BsnI	GGCC	2 cut(s)	436, 541
BsoBI	CYCGRG	1 cut(s)	720
Bsp143I	GATC	8 cut(s)	73, 97, 118, 156, 400, 445, 457, 481
BspACI	CCGC	2 cut(s)	152, 634
BspANI	GGCC	2 cut(s)	436, 541
BspCNI	CTCAG	2 cut(s)	633, 752
BspHI	TCATGA	1 cut(s)	94
BspLI	GGNNCC	2 cut(s)	90, 140
BspMAI	CTGCAG	1 cut(s)	427
BspMI	ACCTGC	1 cut(s)	430
BspPI	GGATC	4 cut(s)	151, 440, 452, 476
BspT107I	GGYRCC	1 cut(s)	88
BsrDI	GCAATG	1 cut(s)	763
BsrI	ACTGG	3 cut(s)	142, 333, 542
BssECI	CCNNGG	1 cut(s)	356
BssMI	GATC	8 cut(s)	73, 97, 118, 156, 400, 445, 457, 481
Bst2UI	CCWGG	1 cut(s)	357
Bst4CI	ACNGT	1 cut(s)	327
BstC8I	GCNNGC	1 cut(s)	646
BstDEI	CTNAG	4 cut(s)	2, 388, 620, 739
BstF5I	GGATG	4 cut(s)	233, 274, 472, 661
BstKTI	GATC	8 cut(s)	76, 100, 121, 159, 403, 448, 460, 484
BstMAI	GTCTC	1 cut(s)	623
BstMBI	GATC	8 cut(s)	73, 97, 118, 156, 400, 445, 457, 481
BstMWI	GCNNNNNNNGC	4 cut(s)	29, 191, 194, 393
BstNI	CCWGG	1 cut(s)	357
BstNSI	RCATGY	1 cut(s)	285
BstSCI	CCNGG	1 cut(s)	355
BstSFI	CTRYAG	1 cut(s)	423
BstV1I	GCAGC	2 cut(s)	172, 181
BstV2I	GAAGAC	1 cut(s)	140
BstX2I	RGATCY	3 cut(s)	73, 156, 457
BstXI	CCANNNNNNTGG	1 cut(s)	652
BstYI	RGATCY	3 cut(s)	73, 156, 457
BsuI	GTATCC	1 cut(s)	256
BsuRI	GGCC	2 cut(s)	436, 541
BtsCI	GGATG	4 cut(s)	233, 274, 472, 661
BtsI	GCAGTG	1 cut(s)	18
BtsIMutI	CAGTG	4 cut(s)	18, 149, 510, 628
BveI	ACCTGC	1 cut(s)	430
Cac8I	GCNNGC	1 cut(s)	646
CciI	TCATGA	1 cut(s)	94
Cfr13I	GGNCC	2 cut(s)	138, 554
Csp6I	GTAC	1 cut(s)	381
CspCI	CAANNNNNGTGG	2 cut(s)	372, 407
CviAII	CATG	3 cut(s)	95, 251, 282
CviQI	GTAC	1 cut(s)	381
DdeI	CTNAG	4 cut(s)	2, 388, 620, 739
DpnI	GATC	8 cut(s)	75, 99, 120, 158, 402, 447, 459, 483
DpnII	GATC	8 cut(s)	73, 97, 118, 156, 400, 445, 457, 481
DraI	TTTAAA	1 cut(s)	748
Eco47I	GGWCC	2 cut(s)	138, 554
Eco57I	CTGAAG	1 cut(s)	294
Eco88I	CYCGRG	1 cut(s)	720
EcoO109I	RGGNCCY	1 cut(s)	138
EcoRI	GAATTC	1 cut(s)	307
EcoRII	CCWGG	1 cut(s)	355
EcoT22I	ATGCAT	1 cut(s)	661
FaeI	CATG	3 cut(s)	98, 254, 285
FaqI	GGGAC	2 cut(s)	124, 374
FatI	CATG	3 cut(s)	94, 250, 281
FbaI	TGATCA	1 cut(s)	118
FblI	GTMKAC	1 cut(s)	329
Fnu4HI	GCNGC	2 cut(s)	186, 195
FokI	GGATG	4 cut(s)	240, 281, 479, 668
Fsp4HI	GCNGC	2 cut(s)	186, 195
FspBI	CTAG	4 cut(s)	101, 207, 378, 494
GluI	GCNGC	2 cut(s)	186, 195
GsuI	CTGGAG	1 cut(s)	339
HaeIII	GGCC	2 cut(s)	436, 541
Hin1II	CATG	3 cut(s)	98, 254, 285
HincII	GTYRAC	1 cut(s)	323
HindII	GTYRAC	1 cut(s)	323
HindIII	AAGCTT	1 cut(s)	385
HinfI	GANTC	2 cut(s)	173, 545
Hpy166II	GTNNAC	2 cut(s)	323, 330
Hpy188I	TCNGA	3 cut(s)	481, 609, 742
Hpy188III	TCNNGA	5 cut(s)	95, 101, 207, 653, 722
Hpy8I	GTNNAC	2 cut(s)	323, 330
HpyAV	CCTTC	2 cut(s)	129, 745
HpyCH4III	ACNGT	1 cut(s)	327
HpyCH4V	TGCA	5 cut(s)	23, 114, 366, 425, 659
HpyF10VI	GCNNNNNNNGC	4 cut(s)	29, 191, 194, 393
HpyF3I	CTNAG	4 cut(s)	2, 388, 620, 739
Hsp92II	CATG	3 cut(s)	98, 254, 285
Ksp22I	TGATCA	1 cut(s)	118
Kzo9I	GATC	8 cut(s)	73, 97, 118, 156, 400, 445, 457, 481
LmnI	GCTCC	2 cut(s)	355, 568
Lsp1109I	GCAGC	2 cut(s)	172, 181
LweI	GCATC	5 cut(s)	94, 172, 259, 277, 646
MaeI	CTAG	4 cut(s)	101, 207, 378, 494
MalI	GATC	8 cut(s)	75, 99, 120, 158, 402, 447, 459, 483
MboI	GATC	8 cut(s)	73, 97, 118, 156, 400, 445, 457, 481
MboII	GAAGA	4 cut(s)	140, 226, 287, 608
MflI	RGATCY	3 cut(s)	73, 156, 457
MluCI	AATT	4 cut(s)	307, 438, 667, 750
MmeI	TCCRAC	1 cut(s)	49
MnlI	CCTC	7 cut(s)	102, 135, 363, 406, 426, 459, 709
Mph1103I	ATGCAT	1 cut(s)	661
MroXI	GAANNNNTTC	1 cut(s)	512
MseI	TTAA	2 cut(s)	441, 747
MspR9I	CCNGG	1 cut(s)	357
MvaI	CCWGG	1 cut(s)	357
MwoI	GCNNNNNNNGC	4 cut(s)	29, 191, 194, 393
NdeII	GATC	8 cut(s)	73, 97, 118, 156, 400, 445, 457, 481
NlaIII	CATG	3 cut(s)	98, 254, 285
NlaIV	GGNNCC	2 cut(s)	90, 140
NsiI	ATGCAT	1 cut(s)	661
NspI	RCATGY	1 cut(s)	285
PaeR7I	CTCGAG	1 cut(s)	720
PagI	TCATGA	1 cut(s)	94
PciI	ACATGT	1 cut(s)	281
PdmI	GAANNNNTTC	1 cut(s)	512
PfeI	GAWTC	2 cut(s)	173, 545
PflMI	CCANNNNNTGG	1 cut(s)	39
PkrI	GCNGC	2 cut(s)	187, 196
PpuMI	RGGWCCY	1 cut(s)	138
PscI	ACATGT	1 cut(s)	281
PshBI	ATTAAT	1 cut(s)	441
Psp5II	RGGWCCY	1 cut(s)	138
Psp6I	CCWGG	1 cut(s)	355
PspGI	CCWGG	1 cut(s)	355
PspN4I	GGNNCC	2 cut(s)	90, 140
PspPI	GGNCC	2 cut(s)	138, 554
PspPPI	RGGWCCY	1 cut(s)	138
PstI	CTGCAG	1 cut(s)	427
PsuI	RGATCY	3 cut(s)	73, 156, 457
RsaI	GTAC	1 cut(s)	382
RsaNI	GTAC	1 cut(s)	381
SaqAI	TTAA	2 cut(s)	441, 747
SatI	GCNGC	2 cut(s)	186, 195
Sau3AI	GATC	8 cut(s)	73, 97, 118, 156, 400, 445, 457, 481
Sau96I	GGNCC	2 cut(s)	138, 554
ScrFI	CCNGG	1 cut(s)	357
SetI	ASST	6 cut(s)	127, 140, 170, 389, 424, 573
SfaNI	GCATC	5 cut(s)	94, 172, 259, 277, 646
SfcI	CTRYAG	1 cut(s)	423
Sfr274I	CTCGAG	1 cut(s)	720
SinI	GGWCC	2 cut(s)	138, 554
SlaI	CTCGAG	1 cut(s)	720
SmlI	CTYRAG	1 cut(s)	720
SmoI	CTYRAG	1 cut(s)	720
Sse9I	AATT	4 cut(s)	307, 438, 667, 750
SsiI	CCGC	2 cut(s)	152, 634
SspMI	CTAG	4 cut(s)	101, 207, 378, 494
StyD4I	CCNGG	1 cut(s)	355
TaaI	ACNGT	1 cut(s)	327
TaqI	TCGA	1 cut(s)	721
TasI	AATT	4 cut(s)	307, 438, 667, 750
TatI	WGTACW	1 cut(s)	380
TfiI	GAWTC	2 cut(s)	173, 545
Tru1I	TTAA	2 cut(s)	441, 747
Tru9I	TTAA	2 cut(s)	441, 747
TscAI	CASTG	4 cut(s)	25, 149, 510, 628
TseI	GCWGC	2 cut(s)	185, 194
TspDTI	ATGAA	2 cut(s)	165, 327
TspGWI	ACGGA	1 cut(s)	308
TspRI	CASTG	4 cut(s)	25, 149, 510, 628
Van91I	CCANNNNNTGG	1 cut(s)	39
VpaK11BI	GGWCC	2 cut(s)	138, 554
VspI	ATTAAT	1 cut(s)	441
XapI	RAATTY	1 cut(s)	307
XbaI	TCTAGA	2 cut(s)	100, 206
XceI	RCATGY	1 cut(s)	285
XhoI	CTCGAG	1 cut(s)	720
XmiI	GTMKAC	1 cut(s)	329
XmnI	GAANNNNTTC	1 cut(s)	512
XspI	CTAG	4 cut(s)	101, 207, 378, 494
Zsp2I	ATGCAT	1 cut(s)	661

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.