Rmu_co8476031.1_g000001

Phosphoglycerate mutase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8476031.1
OG0012251
Physical Location & Seq
Forward (+)
820 .. 1527
708 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8476031.1_g000001.1.cds

Sequence Viewer

Length: 708 bp
atgaattttcctgtggcacagattcaaacctcggatgcacttgcagagatgagccaggggcagtgggagggctgctctcggtctgaaatatacacagctgaagttttgagcttaattgacagacttcagcctgatttctctgcaccatctggagagtcacttaggcaagtagaatttcaaatggtccattttttaaatgggacagtcctggggtttcctgaaaaattgagagcatacttcccatcacacaatcagaatgagagccaaggattctcacaccatagttctcatgcttcaaccaactcaatacatgaccgagatgggccttccctcccaccacctcaatgggatctgcttaacaggcagcggctggggctcttgaggaaaaagtctggtaagagtaggctgcaagttgtgactactaccggagatcatgaggttgaggatgaggtttcccccagtgaaatcagtcaccaaagttctccacatgatttaattggccggatctcctcatctgtttcttgtatcgggattttcagtcatgcagtgccaatcaagtgtctcctcacaggcatccttggttgtagcccagtaatgtcacacaagatttgcatagaagactcttcagtgacagttttgcagcattcatggagaacaggttggcagataaaaaggttgaatgatactgcgcacctcaggcttatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
His_Phos_1

Protein Analysis

235

Amino Acids

26.13

Weight (kDa)

6.34

Isoelectric Point (pI)

59.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012251)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G12850 AT3G26780
fragaria_vesca FvH4_6g54210
malus_domestica MD09G1004000.v1.1 MD17G1007700.v1.1
prunus_persica Prupe.3G312600_v2.0.a1 Prupe.3G312600_v2.0.a1
pyrus_communis pycom111g00300 pycom17g00320
rosa_chinensis RchiOBHm_Chr2g0176401
rosa_laevigata RLG00000022410
rosa_multiflora Rmu_co8476031.1_g000001
rosa_roxburghii Rroxscaffold_2G00076490
rosa_rugosa Rorug02G0593900
rosa_samantha Rh2AG672400 Rh2BG683900 Rh2CG646600 Rh2DG697400
rosa_wichuraiana Rw2G055150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 690
AciI CCGC 1 cut(s) 367
AclWI GGATC 2 cut(s) 357, 512
AcoI YGGCCR 1 cut(s) 499
AcsI RAATTY 2 cut(s) 4, 173
AcuI CTGAAG 3 cut(s) 110, 120, 609
AgsI TTSAA 4 cut(s) 26, 179, 297, 679
AjnI CCWGG 2 cut(s) 54, 207
AluBI AGCT 2 cut(s) 98, 111
AluI AGCT 2 cut(s) 98, 111
Alw26I GTCTC 1 cut(s) 566
AlwI GGATC 2 cut(s) 357, 512
AlwNI CAGNNNCTG 1 cut(s) 370
AoxI GGCC 2 cut(s) 323, 499
ApeKI GCWGC 4 cut(s) 72, 364, 406, 640
ApoI RAATTY 2 cut(s) 4, 173
AspLEI GCGC 1 cut(s) 691
AspS9I GGNCC 2 cut(s) 184, 323
AsuHPI GGTGA 1 cut(s) 464
AvaII GGWCC 1 cut(s) 184
AxyI CCTNAGG 1 cut(s) 695
BanII GRGCYC 1 cut(s) 378
BbsI GAAGAC 1 cut(s) 624
BbvI GCAGC 4 cut(s) 59, 376, 393, 652
BccI CCATC 3 cut(s) 154, 250, 314
BciT130I CCWGG 2 cut(s) 56, 209
BcoDI GTCTC 1 cut(s) 566
BisI GCNGC 5 cut(s) 73, 365, 368, 407, 641
BlsI GCNGC 5 cut(s) 74, 366, 369, 408, 642
Bme1390I CCNGG 2 cut(s) 56, 209
Bme18I GGWCC 1 cut(s) 184
BmgT120I GGNCC 2 cut(s) 184, 323
BmrFI CCNGG 2 cut(s) 56, 209
BmrI ACTGGG 2 cut(s) 453, 584
BmsI GCATC 2 cut(s) 25, 582
BmuI ACTGGG 2 cut(s) 453, 584
BpiI GAAGAC 1 cut(s) 624
BplI GAGNNNNNCTC 2 cut(s) 59, 91
BpmI CTGGAG 1 cut(s) 171
BpuEI CTTGAG 1 cut(s) 400
BsaJI CCNNGG 5 cut(s) 30, 55, 208, 265, 577
BsaWI WCCGGW 1 cut(s) 425
BsaXI ACNNNNNCTCC 2 cut(s) 643, 673
Bse1I ACTGG 2 cut(s) 459, 590
Bse21I CCTNAGG 1 cut(s) 695
BseBI CCWGG 2 cut(s) 56, 209
BseDI CCNNGG 5 cut(s) 30, 55, 208, 265, 577
BseGI GGATG 3 cut(s) 40, 451, 573
BseNI ACTGG 2 cut(s) 459, 590
BseRI GAGGAG 2 cut(s) 499, 554
BseXI GCAGC 4 cut(s) 59, 376, 393, 652
BseYI CCCAGC 1 cut(s) 370
BsgI GTGCAG 1 cut(s) 126
BshFI GGCC 2 cut(s) 325, 501
BsiSI CCGG 2 cut(s) 426, 502
BslFI GGGAC 1 cut(s) 214
BsmAI GTCTC 1 cut(s) 566
BsmFI GGGAC 1 cut(s) 214
BsmI GAATGC 1 cut(s) 643
BsnI GGCC 2 cut(s) 325, 501
Bsp1286I GDGCHC 1 cut(s) 378
Bsp143I GATC 3 cut(s) 349, 430, 504
BspACI CCGC 1 cut(s) 367
BspANI GGCC 2 cut(s) 325, 501
BspCNI CTCAG 1 cut(s) 708
BspHI TCATGA 1 cut(s) 433
BspPI GGATC 2 cut(s) 357, 512
BsrI ACTGG 2 cut(s) 459, 590
BssECI CCNNGG 5 cut(s) 30, 55, 208, 265, 577
BssMI GATC 3 cut(s) 349, 430, 504
BssT1I CCWWGG 2 cut(s) 265, 577
Bst2UI CCWGG 2 cut(s) 56, 209
Bst4CI ACNGT 2 cut(s) 205, 634
Bst6I CTCTTC 1 cut(s) 628
BstDEI CTNAG 2 cut(s) 161, 695
BstF5I GGATG 3 cut(s) 40, 451, 573
BstHHI GCGC 1 cut(s) 691
BstKTI GATC 3 cut(s) 352, 433, 507
BstMAI GTCTC 1 cut(s) 566
BstMBI GATC 3 cut(s) 349, 430, 504
BstMWI GCNNNNNNNGC 3 cut(s) 361, 373, 697
BstNI CCWGG 2 cut(s) 56, 209
BstSCI CCNGG 2 cut(s) 54, 207
BstV1I GCAGC 4 cut(s) 59, 376, 393, 652
BstV2I GAAGAC 1 cut(s) 624
BstX2I RGATCY 2 cut(s) 349, 504
BstXI CCANNNNNNTGG 1 cut(s) 345
BstYI RGATCY 2 cut(s) 349, 504
Bsu36I CCTNAGG 1 cut(s) 695
BsuRI GGCC 2 cut(s) 325, 501
BtsCI GGATG 3 cut(s) 40, 451, 573
BtsI GCAGTG 2 cut(s) 68, 552
BtsIMutI CAGTG 4 cut(s) 68, 466, 552, 633
CaiI CAGNNNCTG 1 cut(s) 370
CciI TCATGA 1 cut(s) 433
CfoI GCGC 1 cut(s) 691
Cfr13I GGNCC 2 cut(s) 184, 323
CviAII CATG 6 cut(s) 290, 311, 434, 488, 542, 648
DdeI CTNAG 2 cut(s) 161, 695
DpnI GATC 3 cut(s) 351, 432, 506
DpnII GATC 3 cut(s) 349, 430, 504
DraI TTTAAA 1 cut(s) 195
EaeI YGGCCR 1 cut(s) 499
Eam1104I CTCTTC 1 cut(s) 628
EarI CTCTTC 1 cut(s) 628
Eco130I CCWWGG 2 cut(s) 265, 577
Eco24I GRGCYC 1 cut(s) 378
Eco47I GGWCC 1 cut(s) 184
Eco57I CTGAAG 3 cut(s) 110, 120, 609
Eco81I CCTNAGG 1 cut(s) 695
EcoRII CCWGG 2 cut(s) 54, 207
EcoT14I CCWWGG 2 cut(s) 265, 577
EcoT38I GRGCYC 1 cut(s) 378
ErhI CCWWGG 2 cut(s) 265, 577
FaeI CATG 6 cut(s) 293, 314, 437, 491, 545, 651
FaqI GGGAC 1 cut(s) 214
FatI CATG 6 cut(s) 289, 310, 433, 487, 541, 647
Fnu4HI GCNGC 5 cut(s) 73, 365, 368, 407, 641
FokI GGATG 3 cut(s) 47, 458, 560
FriOI GRGCYC 1 cut(s) 378
Fsp4HI GCNGC 5 cut(s) 73, 365, 368, 407, 641
FspI TGCGCA 1 cut(s) 690
GlaI GCGC 1 cut(s) 690
GluI GCNGC 5 cut(s) 73, 365, 368, 407, 641
GsaI CCCAGC 1 cut(s) 374
GsuI CTGGAG 1 cut(s) 171
HaeIII GGCC 2 cut(s) 325, 501
HapII CCGG 2 cut(s) 426, 502
HhaI GCGC 1 cut(s) 691
Hin1II CATG 6 cut(s) 293, 314, 437, 491, 545, 651
Hin6I GCGC 1 cut(s) 689
HinP1I GCGC 1 cut(s) 689
HinfI GANTC 4 cut(s) 22, 155, 270, 620
HpaII CCGG 2 cut(s) 426, 502
HphI GGTGA 1 cut(s) 464
Hpy188I TCNGA 3 cut(s) 34, 85, 255
Hpy188III TCNNGA 5 cut(s) 150, 218, 379, 434, 529
HpyAV CCTTC 1 cut(s) 336
HpyCH4III ACNGT 2 cut(s) 205, 634
HpyCH4V TGCA 7 cut(s) 38, 44, 143, 409, 545, 612, 640
HpyF10VI GCNNNNNNNGC 3 cut(s) 361, 373, 697
HpyF3I CTNAG 2 cut(s) 161, 695
Hsp92II CATG 6 cut(s) 293, 314, 437, 491, 545, 651
HspAI GCGC 1 cut(s) 689
Kzo9I GATC 3 cut(s) 349, 430, 504
Lsp1109I GCAGC 4 cut(s) 59, 376, 393, 652
LweI GCATC 2 cut(s) 25, 582
MaeIII GTNAC 5 cut(s) 156, 415, 470, 597, 628
MalI GATC 3 cut(s) 351, 432, 506
MboI GATC 3 cut(s) 349, 430, 504
MboII GAAGA 2 cut(s) 615, 629
MflI RGATCY 2 cut(s) 349, 504
MhlI GDGCHC 1 cut(s) 378
MluCI AATT 5 cut(s) 4, 114, 173, 224, 495
MlyI GAGTC 2 cut(s) 164, 614
MseI TTAA 4 cut(s) 113, 194, 357, 494
MslI CAYNNNNRTG 1 cut(s) 343
MspA1I CMGCKG 2 cut(s) 98, 367
MspI CCGG 2 cut(s) 426, 502
MspR9I CCNGG 2 cut(s) 56, 209
Mva1269I GAATGC 1 cut(s) 643
MvaI CCWGG 2 cut(s) 56, 209
MwoI GCNNNNNNNGC 3 cut(s) 361, 373, 697
NdeII GATC 3 cut(s) 349, 430, 504
NlaIII CATG 6 cut(s) 293, 314, 437, 491, 545, 651
NmuCI GTSAC 5 cut(s) 156, 415, 470, 597, 628
NsbI TGCGCA 1 cut(s) 690
PagI TCATGA 1 cut(s) 433
PctI GAATGC 1 cut(s) 643
PfeI GAWTC 2 cut(s) 22, 270
PkrI GCNGC 5 cut(s) 74, 366, 369, 408, 642
PleI GAGTC 2 cut(s) 163, 614
PpsI GAGTC 2 cut(s) 163, 614
Psp6I CCWGG 2 cut(s) 54, 207
PspFI CCCAGC 1 cut(s) 370
PspGI CCWGG 2 cut(s) 54, 207
PspPI GGNCC 2 cut(s) 184, 323
PstNI CAGNNNCTG 1 cut(s) 370
PsuI RGATCY 2 cut(s) 349, 504
PvuII CAGCTG 1 cut(s) 98
RseI CAYNNNNRTG 1 cut(s) 343
SaqAI TTAA 4 cut(s) 113, 194, 357, 494
SatI GCNGC 5 cut(s) 73, 365, 368, 407, 641
Sau3AI GATC 3 cut(s) 349, 430, 504
Sau96I GGNCC 2 cut(s) 184, 323
SchI GAGTC 2 cut(s) 164, 614
ScrFI CCNGG 2 cut(s) 56, 209
SduI GDGCHC 1 cut(s) 378
SetI ASST 9 cut(s) 32, 100, 113, 343, 441, 453, 661, 677, 696
SfaNI GCATC 2 cut(s) 25, 582
SinI GGWCC 1 cut(s) 184
SmiMI CAYNNNNRTG 1 cut(s) 343
SmlI CTYRAG 1 cut(s) 379
SmoI CTYRAG 1 cut(s) 379
Sse9I AATT 5 cut(s) 4, 114, 173, 224, 495
SsiI CCGC 1 cut(s) 367
StyD4I CCNGG 2 cut(s) 54, 207
StyI CCWWGG 2 cut(s) 265, 577
TaaI ACNGT 2 cut(s) 205, 634
TaqII GACCGA 2 cut(s) 69, 330
TasI AATT 5 cut(s) 4, 114, 173, 224, 495
TauI GCSGC 1 cut(s) 370
TfiI GAWTC 2 cut(s) 22, 270
Tru1I TTAA 4 cut(s) 113, 194, 357, 494
Tru9I TTAA 4 cut(s) 113, 194, 357, 494
TscAI CASTG 4 cut(s) 68, 466, 552, 633
TseFI GTSAC 5 cut(s) 156, 415, 470, 597, 628
TseI GCWGC 4 cut(s) 72, 364, 406, 640
Tsp45I GTSAC 5 cut(s) 156, 415, 470, 597, 628
TspDTI ATGAA 2 cut(s) 17, 636
TspRI CASTG 4 cut(s) 68, 466, 552, 633
VpaK11BI GGWCC 1 cut(s) 184
XapI RAATTY 2 cut(s) 4, 173
XcmI CCANNNNNNNNNTGG 2 cut(s) 194, 342
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.