Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8483441.1

Orthogroup ID

OG0011308

Physical Location & Seq

Genomic Coordinates Reverse (-)

101 .. 1706

Gene Structure 1606 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8483441.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1182 bp

atggaagagttgaggcaagctctaaaacaatctgagaactcaatagggtctttggaatcaaaacttgaatctcttaaagctgagaaagggcaaggtggttgcatcaactatggctctggccaaacagaatcacctgttccttctcaaaaatcggagggacattacccttgcggtaaagagatttgtaaggatgagccatccgctggcagtttcacatgtgaagccttgacaagctgctcaccggaatgccagataccagctacagtgtcagctgaagacactgagactaaacgagaagtttcacaatcattcaagcacgaaaaaatctcaattggggctttctacggtggacttggagggactctaagaaagagaaggggcaagaggaagaggaaggattgtagtagggatgttaaggaggcgagtgttggggatagtggatttttggattcagctgatgctataactgccttgcggtgtatagaacattcaaccagtgagtgtcgtgaggatttgggatcttctggtgcaggtgattggcaaagaggtttgaccaaggatggaactaataagttgttggatgttttcaacaaatttttggaacataaaagtgcttctgtctttcgtcatcgacttgatagccagaagagaagaaggtataagaaaatgatccgtaggcacatggattttgacacaataggatcacgaattgcaagtcattctgtcatgtcagttaaggaactgtttcgagatctgttgctgctcgccaacaatgccctagtgttttactccaagagcacacgtgaatacaagtctgctttgcttcttagagacctcactaccaaaacattgcagcagcatctgaaggattctagcagcaaggctacctctgcaaacctctcctccaatacactagtgtgtaatcctccagttaaacctagaagtgctcgccctggtaaccaaaagctgtcgagaaaagctaccaatgccggaaaggctgctgctaagacttcaaacaaaagtaagaaaaccggtaatgctaatgcagattcttctccttcagtccaatcttttgctgtgacaaaaaggacatctggtcaccaaaggaaagtgggacgtaaaactgttggtcagcaaaatgtagttcctgtgaagggaaggaaaagaggtcgtacaaagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Bromodomain Myb_DNA-binding

Protein Analysis

393

Amino Acids

43.06

Weight (kDa)

9.92

Isoelectric Point (pI)

57.56

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011308)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G61215 AT1G61215
fragaria_vesca	FvH4_3g04470 FvH4_3g04470
malus_domestica	MD05G1322900.v1.1
prunus_persica	Prupe.4G039700_v2.0.a1 Prupe.4G039700_v2.0.a1
rosa_chinensis	RchiOBHm_Chr5g0006871
rosa_laevigata	RLG00000031436
rosa_multiflora	Rmu_co8483441.1_g000001 Rmu_sc0001044.1_g000031 Rmu_sc0012775.1_g000003
rosa_roxburghii	Rroxscaffold_1G00069180
rosa_rugosa	Rorug04G0425200 Rorug04G0425300
rosa_samantha	Rh5AG052900 Rh5BG051900 Rh5CG060400 Rh5DG051000
rosa_wichuraiana	Rw5G005180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	521
Acc36I	ACCTGC	1 cut(s)	521
AccB7I	CCANNNNNTGG	1 cut(s)	203
AciI	CCGC	3 cut(s)	171, 201, 475
AclWI	GGATC	3 cut(s)	526, 664, 709
AcoI	YGGCCR	1 cut(s)	118
AcsI	RAATTY	1 cut(s)	593
AcuI	CTGAAG	3 cut(s)	294, 884, 1044
AcvI	CACGTG	1 cut(s)	803
AfaI	GTAC	1 cut(s)	1174
AfiI	CCNNNNNNNGG	2 cut(s)	203, 1154
AflIII	ACRYGT	2 cut(s)	215, 800
AgeI	ACCGGT	1 cut(s)	1031
AgsI	TTSAA	5 cut(s)	68, 313, 492, 589, 1014
AhdI	GACNNNNNGTC	1 cut(s)	1095
AhlI	ACTAGT	1 cut(s)	913
AjnI	CCWGG	1 cut(s)	952
AleI	CACNNNNGTG	1 cut(s)	916
AluBI	AGCT	8 cut(s)	20, 80, 234, 260, 272, 455, 967, 980
AluI	AGCT	8 cut(s)	20, 80, 234, 260, 272, 455, 967, 980
Alw21I	GWGCWC	2 cut(s)	800, 949
Alw26I	GTCTC	2 cut(s)	278, 825
AlwI	GGATC	3 cut(s)	526, 664, 709
AlwNI	CAGNNNCTG	1 cut(s)	862
AoxI	GGCC	1 cut(s)	118
ApeKI	GCWGC	7 cut(s)	234, 760, 853, 856, 876, 998, 1001
ApoI	RAATTY	1 cut(s)	593
ArsI	GACNNNNNNTTYG	2 cut(s)	700, 732
AsiGI	ACCGGT	1 cut(s)	1031
Asp700I	GAANNNNTTC	1 cut(s)	744
AsuHPI	GGTGA	4 cut(s)	123, 231, 545, 1091
BalI	TGGCCA	1 cut(s)	120
BbrPI	CACGTG	1 cut(s)	803
BbsI	GAAGAC	1 cut(s)	282
Bbv12I	GWGCWC	2 cut(s)	800, 949
BbvI	GCAGC	7 cut(s)	221, 747, 865, 868, 888, 985, 988
BccI	CCATC	2 cut(s)	205, 554
BciT130I	CCWGG	1 cut(s)	954
BcoDI	GTCTC	2 cut(s)	278, 825
BcuI	ACTAGT	1 cut(s)	913
BfaI	CTAG	4 cut(s)	779, 873, 914, 939
BfmI	CTRYAG	1 cut(s)	261
BfuAI	ACCTGC	1 cut(s)	521
BglI	GCCNNNNNGGC	1 cut(s)	995
BglII	AGATCT	1 cut(s)	751
BisI	GCNGC	7 cut(s)	235, 761, 854, 857, 877, 999, 1002
BlsI	GCNGC	7 cut(s)	236, 762, 855, 858, 878, 1000, 1003
Bme1390I	CCNGG	1 cut(s)	954
BmeRI	GACNNNNNGTC	1 cut(s)	1095
BmrFI	CCNGG	1 cut(s)	954
BmsI	GCATC	3 cut(s)	111, 448, 868
BpiI	GAAGAC	1 cut(s)	282
BplI	GAGNNNNNCTC	1 cut(s)	36
BpmI	CTGGAG	1 cut(s)	912
BsaAI	YACGTR	1 cut(s)	803
BsaI	GGTCTC	1 cut(s)	825
BsaJI	CCNNGG	2 cut(s)	555, 952
BsaWI	WCCGGW	2 cut(s)	241, 1031
BsaXI	ACNNNNNCTCC	2 cut(s)	887, 917
Bsc4I	CCNNNNNNNGG	2 cut(s)	203, 1154
Bse118I	RCCGGY	1 cut(s)	1031
Bse1I	ACTGG	2 cut(s)	495, 929
Bse3DI	GCAATG	1 cut(s)	848
BseBI	CCWGG	1 cut(s)	954
BseDI	CCNNGG	2 cut(s)	555, 952
BseGI	GGATG	5 cut(s)	196, 197, 415, 565, 586
BseLI	CCNNNNNNNGG	2 cut(s)	203, 1154
BseMI	GCAATG	1 cut(s)	848
BseMII	CTCAG	3 cut(s)	24, 72, 273
BseNI	ACTGG	2 cut(s)	495, 929
BseRI	GAGGAG	1 cut(s)	892
BseXI	GCAGC	7 cut(s)	221, 747, 865, 868, 888, 985, 988
BsgI	GTGCAG	1 cut(s)	549
BshFI	GGCC	1 cut(s)	120
BshTI	ACCGGT	1 cut(s)	1031
BsiHKAI	GWGCWC	2 cut(s)	800, 949
BsiSI	CCGG	3 cut(s)	242, 990, 1032
BslFI	GGGAC	3 cut(s)	171, 373, 1128
BslI	CCNNNNNNNGG	2 cut(s)	203, 1154
BsmAI	GTCTC	2 cut(s)	278, 825
BsmFI	GGGAC	3 cut(s)	171, 373, 1128
BsmI	GAATGC	1 cut(s)	251
BsnI	GGCC	1 cut(s)	120
Bso31I	GGTCTC	1 cut(s)	825
Bsp1286I	GDGCHC	2 cut(s)	800, 949
Bsp143I	GATC	4 cut(s)	518, 669, 701, 751
BspACI	CCGC	3 cut(s)	171, 201, 475
BspANI	GGCC	1 cut(s)	120
BspCNI	CTCAG	3 cut(s)	25, 73, 274
BspMI	ACCTGC	1 cut(s)	521
BspPI	GGATC	3 cut(s)	526, 664, 709
BspTNI	GGTCTC	1 cut(s)	825
BsrDI	GCAATG	1 cut(s)	848
BsrFI	RCCGGY	1 cut(s)	1031
BsrI	ACTGG	2 cut(s)	495, 929
BssAI	RCCGGY	1 cut(s)	1031
BssECI	CCNNGG	2 cut(s)	555, 952
BssMI	GATC	4 cut(s)	518, 669, 701, 751
BssT1I	CCWWGG	1 cut(s)	555
Bst2UI	CCWGG	1 cut(s)	954
Bst4CI	ACNGT	4 cut(s)	265, 347, 744, 1126
Bst6I	CTCTTC	2 cut(s)	383, 641
BstBAI	YACGTR	1 cut(s)	803
BstC8I	GCNNGC	4 cut(s)	18, 205, 765, 949
BstDEI	CTNAG	6 cut(s)	33, 81, 282, 365, 827, 1005
BstEII	GGTNACC	2 cut(s)	956, 1097
BstF5I	GGATG	5 cut(s)	196, 197, 415, 565, 586
BstKTI	GATC	4 cut(s)	521, 672, 704, 754
BstMAI	GTCTC	2 cut(s)	278, 825
BstMBI	GATC	4 cut(s)	518, 669, 701, 751
BstMWI	GCNNNNNNNGC	5 cut(s)	467, 773, 890, 986, 995
BstNI	CCWGG	1 cut(s)	954
BstNSI	RCATGY	1 cut(s)	219
BstPI	GGTNACC	2 cut(s)	956, 1097
BstSCI	CCNGG	1 cut(s)	952
BstSFI	CTRYAG	1 cut(s)	261
BstV1I	GCAGC	7 cut(s)	221, 747, 865, 868, 888, 985, 988
BstV2I	GAAGAC	1 cut(s)	282
BstX2I	RGATCY	2 cut(s)	518, 751
BstYI	RGATCY	2 cut(s)	518, 751
BsuRI	GGCC	1 cut(s)	120
BtsCI	GGATG	5 cut(s)	196, 197, 415, 565, 586
BtsIMutI	CAGTG	3 cut(s)	270, 279, 502
BveI	ACCTGC	1 cut(s)	521
Cac8I	GCNNGC	4 cut(s)	18, 205, 765, 949
CaiI	CAGNNNCTG	1 cut(s)	862
Cfr10I	RCCGGY	1 cut(s)	1031
Csp6I	GTAC	1 cut(s)	1173
CspAI	ACCGGT	1 cut(s)	1031
CviAII	CATG	3 cut(s)	216, 682, 727
CviQI	GTAC	1 cut(s)	1173
DdeI	CTNAG	6 cut(s)	33, 81, 282, 365, 827, 1005
DpnI	GATC	4 cut(s)	520, 671, 703, 753
DpnII	GATC	4 cut(s)	518, 669, 701, 751
DriI	GACNNNNNGTC	1 cut(s)	1095
EaeI	YGGCCR	1 cut(s)	118
Eam1104I	CTCTTC	2 cut(s)	383, 641
Eam1105I	GACNNNNNGTC	1 cut(s)	1095
EarI	CTCTTC	2 cut(s)	383, 641
Eco130I	CCWWGG	1 cut(s)	555
Eco31I	GGTCTC	1 cut(s)	825
Eco57I	CTGAAG	3 cut(s)	294, 884, 1044
Eco72I	CACGTG	1 cut(s)	803
Eco91I	GGTNACC	2 cut(s)	956, 1097
EcoO65I	GGTNACC	2 cut(s)	956, 1097
EcoRII	CCWGG	1 cut(s)	952
EcoT14I	CCWWGG	1 cut(s)	555
ErhI	CCWWGG	1 cut(s)	555
FaeI	CATG	3 cut(s)	219, 685, 730
FaiI	YATR	8 cut(s)	111, 217, 464, 482, 606, 660, 683, 728
FaqI	GGGAC	3 cut(s)	171, 373, 1128
FatI	CATG	3 cut(s)	215, 681, 726
Fnu4HI	GCNGC	7 cut(s)	235, 761, 854, 857, 877, 999, 1002
FokI	GGATG	5 cut(s)	184, 203, 422, 572, 593
Fsp4HI	GCNGC	7 cut(s)	235, 761, 854, 857, 877, 999, 1002
FspBI	CTAG	4 cut(s)	779, 873, 914, 939
GluI	GCNGC	7 cut(s)	235, 761, 854, 857, 877, 999, 1002
GsuI	CTGGAG	1 cut(s)	912
HaeIII	GGCC	1 cut(s)	120
HapII	CCGG	3 cut(s)	242, 990, 1032
Hin1II	CATG	3 cut(s)	219, 685, 730
HinfI	GANTC	7 cut(s)	56, 68, 128, 361, 449, 869, 1049
HpaII	CCGG	3 cut(s)	242, 990, 1032
HphI	GGTGA	4 cut(s)	123, 231, 545, 1091
Hpy166II	GTNNAC	1 cut(s)	350
Hpy188I	TCNGA	3 cut(s)	34, 154, 864
Hpy188III	TCNNGA	4 cut(s)	506, 705, 749, 972
Hpy8I	GTNNAC	1 cut(s)	350
HpyAV	CCTTC	8 cut(s)	150, 369, 388, 648, 859, 1068, 1147, 1152
HpyCH4III	ACNGT	4 cut(s)	265, 347, 744, 1126
HpyCH4IV	ACGT	2 cut(s)	802, 1117
HpyCH4V	TGCA	6 cut(s)	102, 530, 713, 853, 893, 1046
HpyF10VI	GCNNNNNNNGC	5 cut(s)	467, 773, 890, 986, 995
HpyF3I	CTNAG	6 cut(s)	33, 81, 282, 365, 827, 1005
HpySE526I	ACGT	2 cut(s)	802, 1117
Hsp92II	CATG	3 cut(s)	219, 685, 730
Kzo9I	GATC	4 cut(s)	518, 669, 701, 751
Lsp1109I	GCAGC	7 cut(s)	221, 747, 865, 868, 888, 985, 988
LweI	GCATC	3 cut(s)	111, 448, 868
MaeI	CTAG	4 cut(s)	779, 873, 914, 939
MaeII	ACGT	2 cut(s)	802, 1117
MaeIII	GTNAC	3 cut(s)	956, 1078, 1097
MalI	GATC	4 cut(s)	520, 671, 703, 753
MboI	GATC	4 cut(s)	518, 669, 701, 751
MboII	GAAGA	7 cut(s)	17, 287, 400, 513, 658, 663, 1044
MfeI	CAATTG	1 cut(s)	330
MflI	RGATCY	2 cut(s)	518, 751
MhlI	GDGCHC	2 cut(s)	800, 949
MlsI	TGGCCA	1 cut(s)	120
MluCI	AATT	3 cut(s)	330, 593, 708
MluNI	TGGCCA	1 cut(s)	120
MlyI	GAGTC	1 cut(s)	355
MmeI	TCCRAC	1 cut(s)	558
Mox20I	TGGCCA	1 cut(s)	120
MroXI	GAANNNNTTC	1 cut(s)	744
MscI	TGGCCA	1 cut(s)	120
MseI	TTAA	4 cut(s)	75, 414, 735, 933
MslI	CAYNNNNRTG	3 cut(s)	244, 609, 916
Msp20I	TGGCCA	1 cut(s)	120
MspA1I	CMGCKG	3 cut(s)	203, 272, 455
MspI	CCGG	3 cut(s)	242, 990, 1032
MspR9I	CCNGG	1 cut(s)	954
MunI	CAATTG	1 cut(s)	330
Mva1269I	GAATGC	1 cut(s)	251
MvaI	CCWGG	1 cut(s)	954
MwoI	GCNNNNNNNGC	5 cut(s)	467, 773, 890, 986, 995
NdeII	GATC	4 cut(s)	518, 669, 701, 751
NlaIII	CATG	3 cut(s)	219, 685, 730
NmuCI	GTSAC	2 cut(s)	1078, 1097
NspI	RCATGY	1 cut(s)	219
OliI	CACNNNNGTG	1 cut(s)	916
PaqCI	CACCTGC	1 cut(s)	521
PciI	ACATGT	1 cut(s)	215
PctI	GAATGC	1 cut(s)	251
PdmI	GAANNNNTTC	1 cut(s)	744
PfeI	GAWTC	6 cut(s)	56, 68, 128, 449, 869, 1049
PflMI	CCANNNNNTGG	1 cut(s)	203
PinAI	ACCGGT	1 cut(s)	1031
PkrI	GCNGC	7 cut(s)	236, 762, 855, 858, 878, 1000, 1003
PleI	GAGTC	1 cut(s)	355
PmaCI	CACGTG	1 cut(s)	803
PmlI	CACGTG	1 cut(s)	803
PpsI	GAGTC	1 cut(s)	355
Ppu21I	YACGTR	1 cut(s)	803
PscI	ACATGT	1 cut(s)	215
Psp6I	CCWGG	1 cut(s)	952
PspCI	CACGTG	1 cut(s)	803
PspEI	GGTNACC	2 cut(s)	956, 1097
PspGI	CCWGG	1 cut(s)	952
PstNI	CAGNNNCTG	1 cut(s)	862
PsuI	RGATCY	2 cut(s)	518, 751
PvuII	CAGCTG	2 cut(s)	272, 455
RsaI	GTAC	1 cut(s)	1174
RsaNI	GTAC	1 cut(s)	1173
RseI	CAYNNNNRTG	3 cut(s)	244, 609, 916
SaqAI	TTAA	4 cut(s)	75, 414, 735, 933
SatI	GCNGC	7 cut(s)	235, 761, 854, 857, 877, 999, 1002
Sau3AI	GATC	4 cut(s)	518, 669, 701, 751
SchI	GAGTC	1 cut(s)	355
ScrFI	CCNGG	1 cut(s)	954
SduI	GDGCHC	2 cut(s)	800, 949
SfaNI	GCATC	3 cut(s)	111, 448, 868
SfcI	CTRYAG	1 cut(s)	261
SmiMI	CAYNNNNRTG	3 cut(s)	244, 609, 916
SpeI	ACTAGT	1 cut(s)	913
Sse9I	AATT	3 cut(s)	330, 593, 708
SsiI	CCGC	3 cut(s)	171, 201, 475
SspMI	CTAG	4 cut(s)	779, 873, 914, 939
StyD4I	CCNGG	1 cut(s)	952
StyI	CCWWGG	1 cut(s)	555
TaaI	ACNGT	4 cut(s)	265, 347, 744, 1126
TaiI	ACGT	2 cut(s)	805, 1120
TaqI	TCGA	3 cut(s)	631, 748, 971
TasI	AATT	3 cut(s)	330, 593, 708
TfiI	GAWTC	6 cut(s)	56, 68, 128, 449, 869, 1049
Tru1I	TTAA	4 cut(s)	75, 414, 735, 933
Tru9I	TTAA	4 cut(s)	75, 414, 735, 933
TscAI	CASTG	3 cut(s)	270, 286, 502
TseFI	GTSAC	2 cut(s)	1078, 1097
TseI	GCWGC	7 cut(s)	234, 760, 853, 856, 876, 998, 1001
Tsp45I	GTSAC	2 cut(s)	1078, 1097
TspGWI	ACGGA	1 cut(s)	662
TspRI	CASTG	3 cut(s)	270, 286, 502
Van91I	CCANNNNNTGG	1 cut(s)	203
XapI	RAATTY	1 cut(s)	593
XceI	RCATGY	1 cut(s)	219
XmnI	GAANNNNTTC	1 cut(s)	744
XspI	CTAG	4 cut(s)	779, 873, 914, 939

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.