Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000030.1

Orthogroup ID

OG0015541

Physical Location & Seq

Genomic Coordinates Reverse (-)

40432 .. 41469

Gene Structure 1038 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000030.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1038 bp

atggtgtctggatacaccgccattggagatgttgaatcagccagtaacttgttcagtcagatgccggttaaaaatgttgtatcgtggaatgctatgattgcaggttatgttcataaccacatgtttgatcaagctctttctgttttccgcaagatgttgatagatggcaagtgcaggcctgatcagagtactttgatcagtgtactatcggcatgtactcacttgggttctcttgaacatggaaaatggatcgagtcttatattaagagaaacaagttagacatgtctgtacctttaggaaatgctctaatagacatgtatgcaaagtgtggagatgtagaaaatgcaaaagctgtttttgatgagatggaacaaagatgtataattacatggacgacaatggtttcaggtctagctgttaatgggtggtgcagggaagcattagctctctttgaaacaatgtgtttaagcggacataaaccagatgatgtgattttcattgcggctctatcagcttgcactcatggagggctggtagacgagggcaaaataattttttatcagatggaacacgagtttgacatcaagccccgaatagagcattttgggtgcatggttgatcttctaggtagagctgggaagttggaagaagcactcaggtttgtagaaaacatgcatttggagccaaatgctgtaatttgggctagtctactgggttcctgtaagattcatggaaatggagatctggtggagtctgtaaccaggcggattatagagcaggaaccggaaaatcccagctatttaactctagtttccaatttgagtgcatcagtcggacagtggaaagatgtgctgatctatcggcaagttatgagacaacaggggatagaaaaggttcctggttgtagctcaatccaaatggggaacaagatagatgagtttcttgcccatgatacaagacatgaggaaagaaaagaaatttatggagttttgaattgtttaaatgaacaggtgtcagcagtttctgatgggctatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

345

Amino Acids

38.45

Weight (kDa)

5.39

Isoelectric Point (pI)

40.65

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015541)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g14810
malus_domestica	MD14G1026500.v1.1
prunus_persica	Prupe.8G017600_v2.0.a1
pyrus_communis	pycom14g02530
rosa_chinensis	RchiOBHm_Chr6g0277401
rosa_laevigata	RLG00000013305
rosa_multiflora	Rmu_co8455877.1_g000001 Rmu_sc0000030.1_g000006 Rmu_sc0004888.1_g000004
rosa_roxburghii	Rroxscaffold_7G00191380
rosa_rugosa	Rorug06G0107800 Rorug06G0107800 Rorug06G0107800 Rorug06G0107900
rosa_samantha	Rh6DG215400
rosa_wichuraiana	Rw6G019160

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	92
AccI	GTMKAC	2 cut(s)	537, 709
AciI	CCGC	5 cut(s)	18, 148, 471, 503, 766
AclWI	GGATC	1 cut(s)	257
AcsI	RAATTY	1 cut(s)	978
AfaI	GTAC	4 cut(s)	190, 204, 217, 291
AflIII	ACRYGT	3 cut(s)	120, 282, 315
AgsI	TTSAA	4 cut(s)	35, 236, 455, 994
AjnI	CCWGG	2 cut(s)	761, 898
AluBI	AGCT	8 cut(s)	134, 353, 416, 446, 515, 635, 798, 909
AluI	AGCT	8 cut(s)	134, 353, 416, 446, 515, 635, 798, 909
Alw26I	GTCTC	1 cut(s)	868
AlwI	GGATC	1 cut(s)	257
AlwNI	CAGNNNCTG	1 cut(s)	1025
AoxI	GGCC	1 cut(s)	176
ApoI	RAATTY	1 cut(s)	978
Asp700I	GAANNNNTTC	1 cut(s)	894
BauI	CACGAG	1 cut(s)	572
BccI	CCATC	4 cut(s)	158, 361, 559, 1022
BciT130I	CCWGG	2 cut(s)	763, 900
BciVI	GTATCC	1 cut(s)	5
BclI	TGATCA	3 cut(s)	127, 181, 195
BcoDI	GTCTC	1 cut(s)	868
BfaI	CTAG	4 cut(s)	413, 626, 705, 809
BfuAI	ACCTGC	1 cut(s)	92
BfuI	GTATCC	1 cut(s)	5
BglII	AGATCT	1 cut(s)	742
BisI	GCNGC	1 cut(s)	504
BlsI	GCNGC	1 cut(s)	505
BmcAI	AGTACT	1 cut(s)	190
Bme1390I	CCNGG	2 cut(s)	763, 900
BmiI	GGNNCC	4 cut(s)	684, 718, 783, 897
BmrFI	CCNGG	2 cut(s)	763, 900
BmrI	ACTGGG	1 cut(s)	722
BmsI	GCATC	2 cut(s)	51, 836
BmuI	ACTGGG	1 cut(s)	722
BsaWI	WCCGGW	1 cut(s)	784
BsaXI	ACNNNNNCTCC	4 cut(s)	519, 549, 732, 762
Bse118I	RCCGGY	1 cut(s)	64
Bse1I	ACTGG	2 cut(s)	42, 717
Bse3DI	GCAATG	1 cut(s)	498
BseBI	CCWGG	2 cut(s)	763, 900
BseMI	GCAATG	1 cut(s)	498
BseMII	CTCAG	1 cut(s)	670
BseNI	ACTGG	2 cut(s)	42, 717
BseYI	CCCAGC	2 cut(s)	635, 794
BsgI	GTGCAG	2 cut(s)	193, 451
BshFI	GGCC	1 cut(s)	178
BsiSI	CCGG	2 cut(s)	65, 785
BsmAI	GTCTC	1 cut(s)	868
BsmI	GAATGC	1 cut(s)	94
BsnI	GGCC	1 cut(s)	178
Bsp143I	GATC	7 cut(s)	127, 181, 195, 249, 619, 742, 855
BspACI	CCGC	5 cut(s)	18, 148, 471, 503, 766
BspANI	GGCC	1 cut(s)	178
BspCNI	CTCAG	1 cut(s)	669
BspLI	GGNNCC	4 cut(s)	684, 718, 783, 897
BspMI	ACCTGC	1 cut(s)	92
BspPI	GGATC	1 cut(s)	257
BsrDI	GCAATG	1 cut(s)	498
BsrFI	RCCGGY	1 cut(s)	64
BsrI	ACTGG	2 cut(s)	42, 717
BssAI	RCCGGY	1 cut(s)	64
BssMI	GATC	7 cut(s)	127, 181, 195, 249, 619, 742, 855
BssSI	CACGAG	1 cut(s)	572
Bst2BI	CACGAG	1 cut(s)	572
Bst2UI	CCWGG	2 cut(s)	763, 900
Bst4CI	ACNGT	1 cut(s)	840
BstC8I	GCNNGC	2 cut(s)	176, 517
BstDEI	CTNAG	1 cut(s)	656
BstKTI	GATC	7 cut(s)	130, 184, 198, 252, 622, 745, 858
BstMAI	GTCTC	1 cut(s)	868
BstMBI	GATC	7 cut(s)	127, 181, 195, 249, 619, 742, 855
BstMWI	GCNNNNNNNGC	3 cut(s)	98, 512, 682
BstNI	CCWGG	2 cut(s)	763, 900
BstNSI	RCATGY	5 cut(s)	124, 216, 286, 319, 676
BstSCI	CCNGG	2 cut(s)	761, 898
BstX2I	RGATCY	1 cut(s)	742
BstYI	RGATCY	1 cut(s)	742
BsuI	GTATCC	1 cut(s)	5
BsuRI	GGCC	1 cut(s)	178
BtsIMutI	CAGTG	2 cut(s)	205, 845
BveI	ACCTGC	1 cut(s)	92
Cac8I	GCNNGC	2 cut(s)	176, 517
CaiI	CAGNNNCTG	1 cut(s)	1025
Cfr10I	RCCGGY	1 cut(s)	64
Csp6I	GTAC	4 cut(s)	189, 203, 216, 290
CviQI	GTAC	4 cut(s)	189, 203, 216, 290
DdeI	CTNAG	1 cut(s)	656
DpnI	GATC	7 cut(s)	129, 183, 197, 251, 621, 744, 857
DpnII	GATC	7 cut(s)	127, 181, 195, 249, 619, 742, 855
DraI	TTTAAA	1 cut(s)	1002
EciI	GGCGGA	1 cut(s)	781
Eco147I	AGGCCT	1 cut(s)	178
EcoRII	CCWGG	2 cut(s)	761, 898
EcoT22I	ATGCAT	1 cut(s)	678
FbaI	TGATCA	3 cut(s)	127, 181, 195
FblI	GTMKAC	2 cut(s)	537, 709
Fnu4HI	GCNGC	1 cut(s)	504
Fsp4HI	GCNGC	1 cut(s)	504
FspBI	CTAG	4 cut(s)	413, 626, 705, 809
GluI	GCNGC	1 cut(s)	504
GsaI	CCCAGC	2 cut(s)	639, 798
HaeIII	GGCC	1 cut(s)	178
HapII	CCGG	2 cut(s)	65, 785
HinfI	GANTC	4 cut(s)	35, 254, 727, 752
HpaII	CCGG	2 cut(s)	65, 785
Hpy166II	GTNNAC	3 cut(s)	203, 538, 710
Hpy188I	TCNGA	5 cut(s)	60, 186, 564, 836, 1027
Hpy188III	TCNNGA	2 cut(s)	9, 233
Hpy8I	GTNNAC	3 cut(s)	203, 538, 710
HpyCH4III	ACNGT	1 cut(s)	840
HpyCH4V	TGCA	9 cut(s)	101, 174, 323, 347, 432, 519, 612, 676, 827
HpyF10VI	GCNNNNNNNGC	3 cut(s)	98, 512, 682
HpyF3I	CTNAG	1 cut(s)	656
Ksp22I	TGATCA	3 cut(s)	127, 181, 195
Kzo9I	GATC	7 cut(s)	127, 181, 195, 249, 619, 742, 855
LmnI	GCTCC	1 cut(s)	682
LweI	GCATC	2 cut(s)	51, 836
MaeI	CTAG	4 cut(s)	413, 626, 705, 809
MaeIII	GTNAC	2 cut(s)	44, 757
MalI	GATC	7 cut(s)	129, 183, 197, 251, 621, 744, 857
MboI	GATC	7 cut(s)	127, 181, 195, 249, 619, 742, 855
MboII	GAAGA	2 cut(s)	614, 659
MflI	RGATCY	1 cut(s)	742
MluCI	AATT	6 cut(s)	384, 552, 696, 817, 978, 994
MlyI	GAGTC	2 cut(s)	263, 761
MmeI	TCCRAC	2 cut(s)	624, 814
MnlI	CCTC	3 cut(s)	521, 535, 958
Mph1103I	ATGCAT	1 cut(s)	678
MroXI	GAANNNNTTC	1 cut(s)	894
MseI	TTAA	6 cut(s)	69, 264, 420, 467, 803, 1001
MslI	CAYNNNNRTG	1 cut(s)	735
MspI	CCGG	2 cut(s)	65, 785
MspR9I	CCNGG	2 cut(s)	763, 900
Mva1269I	GAATGC	1 cut(s)	94
MvaI	CCWGG	2 cut(s)	763, 900
MwoI	GCNNNNNNNGC	3 cut(s)	98, 512, 682
NdeII	GATC	7 cut(s)	127, 181, 195, 249, 619, 742, 855
NlaIV	GGNNCC	4 cut(s)	684, 718, 783, 897
NsiI	ATGCAT	1 cut(s)	678
NspI	RCATGY	5 cut(s)	124, 216, 286, 319, 676
PceI	AGGCCT	1 cut(s)	178
PciI	ACATGT	3 cut(s)	120, 282, 315
PctI	GAATGC	1 cut(s)	94
PdmI	GAANNNNTTC	1 cut(s)	894
PfeI	GAWTC	2 cut(s)	35, 727
PkrI	GCNGC	1 cut(s)	505
PleI	GAGTC	2 cut(s)	262, 760
PpsI	GAGTC	2 cut(s)	262, 760
PscI	ACATGT	3 cut(s)	120, 282, 315
Psp6I	CCWGG	2 cut(s)	761, 898
PspFI	CCCAGC	2 cut(s)	635, 794
PspGI	CCWGG	2 cut(s)	761, 898
PspN4I	GGNNCC	4 cut(s)	684, 718, 783, 897
PstNI	CAGNNNCTG	1 cut(s)	1025
PsuI	RGATCY	1 cut(s)	742
RsaI	GTAC	4 cut(s)	190, 204, 217, 291
RsaNI	GTAC	4 cut(s)	189, 203, 216, 290
RseI	CAYNNNNRTG	1 cut(s)	735
SaqAI	TTAA	6 cut(s)	69, 264, 420, 467, 803, 1001
SatI	GCNGC	1 cut(s)	504
Sau3AI	GATC	7 cut(s)	127, 181, 195, 249, 619, 742, 855
ScaI	AGTACT	1 cut(s)	190
SchI	GAGTC	2 cut(s)	263, 761
ScrFI	CCNGG	2 cut(s)	763, 900
SfaNI	GCATC	2 cut(s)	51, 836
SmiMI	CAYNNNNRTG	1 cut(s)	735
Sse9I	AATT	6 cut(s)	384, 552, 696, 817, 978, 994
SseBI	AGGCCT	1 cut(s)	178
SsiI	CCGC	5 cut(s)	18, 148, 471, 503, 766
SspMI	CTAG	4 cut(s)	413, 626, 705, 809
StuI	AGGCCT	1 cut(s)	178
StyD4I	CCNGG	2 cut(s)	761, 898
TaaI	ACNGT	1 cut(s)	840
TaqI	TCGA	1 cut(s)	252
TasI	AATT	6 cut(s)	384, 552, 696, 817, 978, 994
TatI	WGTACW	3 cut(s)	188, 202, 215
TauI	GCSGC	1 cut(s)	506
TfiI	GAWTC	2 cut(s)	35, 727
Tru1I	TTAA	6 cut(s)	69, 264, 420, 467, 803, 1001
Tru9I	TTAA	6 cut(s)	69, 264, 420, 467, 803, 1001
TscAI	CASTG	2 cut(s)	205, 845
TspDTI	ATGAA	4 cut(s)	101, 487, 719, 1020
TspRI	CASTG	2 cut(s)	205, 845
XapI	RAATTY	1 cut(s)	978
XceI	RCATGY	5 cut(s)	124, 216, 286, 319, 676
XmiI	GTMKAC	2 cut(s)	537, 709
XmnI	GAANNNNTTC	1 cut(s)	894
XspI	CTAG	4 cut(s)	413, 626, 705, 809
ZrmI	AGTACT	1 cut(s)	190
Zsp2I	ATGCAT	1 cut(s)	678

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.