Rmu_sc0000060.1_g000053

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000060.1
Physical Location & Seq
Forward (+)
247687 .. 248469
783 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000060.1_g000053.1.cds

Sequence Viewer

Length: 405 bp
atgcgaatcaagcagataattaagcatctgtctgactcatcagctagcaaaggaaaaatgagcaagccttcccatagagtagtgcttacgaagcttgttttataccttaacttcctactctggcagcttggatctgaactcaaattccaggctacagcacaactcccacagaatgaagtgtatgctgtcacaaccattataaacaagttggggttaaagccagcgccattgatatctaatacatactgccagacaagggtctccacttacggaattgcaatcctttgtacttgtaacaaccagagtacggtttgccatatcacaagcatttccgtgaacaacatagatttaactacagatataccagaagaagtgggtgatcttccgtccttgtcgtctctgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

134

Amino Acids

14.75

Weight (kDa)

8.96

Isoelectric Point (pI)

45.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018537)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 200
AclWI GGATC 1 cut(s) 139
AcsI RAATTY 1 cut(s) 143
AfaI GTAC 2 cut(s) 289, 307
AfiI CCNNNNNNNGG 2 cut(s) 256, 307
AjnI CCWGG 1 cut(s) 147
AloI GAACNNNNNNTCC 2 cut(s) 129, 161
AluBI AGCT 3 cut(s) 44, 94, 127
AluI AGCT 3 cut(s) 44, 94, 127
Alw26I GTCTC 1 cut(s) 265
AlwI GGATC 1 cut(s) 139
ApeKI GCWGC 1 cut(s) 124
ApoI RAATTY 1 cut(s) 143
AspLEI GCGC 1 cut(s) 226
AsuHPI GGTGA 1 cut(s) 389
AsuNHI GCTAGC 1 cut(s) 44
BbvI GCAGC 1 cut(s) 136
BciT130I CCWGG 1 cut(s) 149
BcoDI GTCTC 1 cut(s) 265
BfaI CTAG 1 cut(s) 45
BfmI CTRYAG 2 cut(s) 153, 354
BfoI RGCGCY 1 cut(s) 227
BisI GCNGC 1 cut(s) 125
BlsI GCNGC 1 cut(s) 126
Bme1390I CCNGG 1 cut(s) 149
BmrFI CCNGG 1 cut(s) 149
BmsI GCATC 1 cut(s) 34
BmtI GCTAGC 1 cut(s) 48
BoxI GACNNNNGTC 1 cut(s) 257
BsaI GGTCTC 1 cut(s) 265
Bsc4I CCNNNNNNNGG 2 cut(s) 256, 307
BseBI CCWGG 1 cut(s) 149
BseLI CCNNNNNNNGG 2 cut(s) 256, 307
BseXI GCAGC 1 cut(s) 136
BslI CCNNNNNNNGG 2 cut(s) 256, 307
BsmAI GTCTC 1 cut(s) 265
Bso31I GGTCTC 1 cut(s) 265
Bsp143I GATC 2 cut(s) 131, 379
BspOI GCTAGC 1 cut(s) 48
BspPI GGATC 1 cut(s) 139
BspTNI GGTCTC 1 cut(s) 265
BssMI GATC 2 cut(s) 131, 379
Bst2UI CCWGG 1 cut(s) 149
Bst4CI ACNGT 1 cut(s) 310
BstC8I GCNNGC 3 cut(s) 46, 65, 222
BstH2I RGCGCY 1 cut(s) 227
BstHHI GCGC 1 cut(s) 226
BstKTI GATC 2 cut(s) 134, 382
BstMAI GTCTC 1 cut(s) 265
BstMBI GATC 2 cut(s) 131, 379
BstMWI GCNNNNNNNGC 2 cut(s) 10, 91
BstNI CCWGG 1 cut(s) 149
BstPAI GACNNNNGTC 1 cut(s) 257
BstSCI CCNGG 1 cut(s) 147
BstSFI CTRYAG 2 cut(s) 153, 354
BstV1I GCAGC 1 cut(s) 136
BstX2I RGATCY 1 cut(s) 131
BstYI RGATCY 1 cut(s) 131
Cac8I GCNNGC 3 cut(s) 46, 65, 222
CfoI GCGC 1 cut(s) 226
Csp6I GTAC 2 cut(s) 288, 306
CviJI RGCY 6 cut(s) 44, 67, 94, 127, 152, 220
CviKI_1 RGCY 6 cut(s) 44, 67, 94, 127, 152, 220
CviQI GTAC 2 cut(s) 288, 306
DpnI GATC 2 cut(s) 133, 381
DpnII GATC 2 cut(s) 131, 379
Eco31I GGTCTC 1 cut(s) 265
Eco32I GATATC 1 cut(s) 234
EcoRII CCWGG 1 cut(s) 147
EcoRV GATATC 1 cut(s) 234
FaiI YATR 8 cut(s) 75, 103, 183, 200, 244, 318, 344, 362
Fnu4HI GCNGC 1 cut(s) 125
Fsp4HI GCNGC 1 cut(s) 125
FspBI CTAG 1 cut(s) 45
GlaI GCGC 1 cut(s) 225
GluI GCNGC 1 cut(s) 125
HaeII RGCGCY 1 cut(s) 227
HhaI GCGC 1 cut(s) 226
Hin6I GCGC 1 cut(s) 224
HinP1I GCGC 1 cut(s) 224
HindIII AAGCTT 1 cut(s) 92
HinfI GANTC 2 cut(s) 6, 35
HphI GGTGA 1 cut(s) 389
Hpy166II GTNNAC 1 cut(s) 337
Hpy188I TCNGA 2 cut(s) 34, 136
Hpy8I GTNNAC 1 cut(s) 337
HpyAV CCTTC 1 cut(s) 78
HpyCH4III ACNGT 1 cut(s) 310
HpyCH4V TGCA 1 cut(s) 278
HpyF10VI GCNNNNNNNGC 2 cut(s) 10, 91
HspAI GCGC 1 cut(s) 224
Kzo9I GATC 2 cut(s) 131, 379
LpnPI CCDG 7 cut(s) 106, 134, 161, 234, 263, 314, 378
Lsp1109I GCAGC 1 cut(s) 136
LweI GCATC 1 cut(s) 34
MaeI CTAG 1 cut(s) 45
MaeIII GTNAC 2 cut(s) 187, 293
MalI GATC 2 cut(s) 133, 381
MboI GATC 2 cut(s) 131, 379
MboII GAAGA 2 cut(s) 374, 380
MflI RGATCY 1 cut(s) 131
MluCI AATT 3 cut(s) 18, 143, 273
MlyI GAGTC 1 cut(s) 29
MseI TTAA 4 cut(s) 21, 108, 215, 350
MslI CAYNNNNRTG 1 cut(s) 332
MspR9I CCNGG 1 cut(s) 149
MvaI CCWGG 1 cut(s) 149
MwoI GCNNNNNNNGC 2 cut(s) 10, 91
NdeII GATC 2 cut(s) 131, 379
NheI GCTAGC 1 cut(s) 44
NmuCI GTSAC 1 cut(s) 187
PfeI GAWTC 1 cut(s) 6
PkrI GCNGC 1 cut(s) 126
PleI GAGTC 1 cut(s) 29
PpsI GAGTC 1 cut(s) 29
PshAI GACNNNNGTC 1 cut(s) 257
PsiI TTATAA 1 cut(s) 200
Psp6I CCWGG 1 cut(s) 147
PspGI CCWGG 1 cut(s) 147
PsuI RGATCY 1 cut(s) 131
RsaI GTAC 2 cut(s) 289, 307
RsaNI GTAC 2 cut(s) 288, 306
RseI CAYNNNNRTG 1 cut(s) 332
SaqAI TTAA 4 cut(s) 21, 108, 215, 350
SatI GCNGC 1 cut(s) 125
Sau3AI GATC 2 cut(s) 131, 379
SchI GAGTC 1 cut(s) 29
ScrFI CCNGG 1 cut(s) 149
SetI ASST 4 cut(s) 46, 96, 108, 129
SfaNI GCATC 1 cut(s) 34
SfcI CTRYAG 2 cut(s) 153, 354
SmiMI CAYNNNNRTG 1 cut(s) 332
Sse9I AATT 3 cut(s) 18, 143, 273
SspMI CTAG 1 cut(s) 45
StyD4I CCNGG 1 cut(s) 147
TaaI ACNGT 1 cut(s) 310
TasI AATT 3 cut(s) 18, 143, 273
TatI WGTACW 1 cut(s) 287
TfiI GAWTC 1 cut(s) 6
Tru1I TTAA 4 cut(s) 21, 108, 215, 350
Tru9I TTAA 4 cut(s) 21, 108, 215, 350
TseFI GTSAC 1 cut(s) 187
TseI GCWGC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 187
TspDTI ATGAA 1 cut(s) 189
TspGWI ACGGA 3 cut(s) 285, 322, 375
XapI RAATTY 1 cut(s) 143
XspI CTAG 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.