Rh1DG095500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
18042262 .. 18042498
237 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG095500.1

Sequence Viewer

Length: 237 bp
ATGGGTTGTGCAAGATCGGCGGAGATTGCTGGGTTTCGAGCCTTCGAAGGAGAGGGCGGAGAGGCGGAGAGGCGGAGCCTTCGAGGCCTCGAGCCCTCGAGGGAAAGAGAGATGGGCTGTGCAAGATCGGCGGAGATTTCTGGGTTTCGAGCCTTCGAAGGAGAGGGCGGAGAGGCGGAGCCTTCGAGGCCTCGAGGGAAAGAGTGGCTGAGAGTGGCTGAGTGGGAACTGGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.62

Weight (kDa)

4.98

Isoelectric Point (pI)

54.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018537)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 2 cut(s) 97, 192
AciI CCGC 7 cut(s) 20, 57, 65, 73, 131, 168, 176
Ama87I CYCGRG 3 cut(s) 89, 97, 192
AoxI GGCC 2 cut(s) 85, 188
AsuII TTCGAA 2 cut(s) 45, 156
AvaI CYCGRG 3 cut(s) 89, 97, 192
BanII GRGCYC 1 cut(s) 96
BccI CCATC 1 cut(s) 106
BglI GCCNNNNNGGC 2 cut(s) 84, 187
BmeT110I CYCGRG 3 cut(s) 89, 97, 192
BmiI GGNNCC 2 cut(s) 77, 180
Bpu14I TTCGAA 2 cut(s) 45, 156
Bse1I ACTGG 1 cut(s) 234
BseMII CTCAG 2 cut(s) 200, 210
BseNI ACTGG 1 cut(s) 234
BseYI CCCAGC 1 cut(s) 29
BshFI GGCC 2 cut(s) 87, 190
BsiHKCI CYCGRG 3 cut(s) 89, 97, 192
BsnI GGCC 2 cut(s) 87, 190
BsoBI CYCGRG 3 cut(s) 89, 97, 192
Bsp119I TTCGAA 2 cut(s) 45, 156
Bsp1286I GDGCHC 1 cut(s) 96
Bsp143I GATC 2 cut(s) 14, 125
BspACI CCGC 7 cut(s) 20, 57, 65, 73, 131, 168, 176
BspANI GGCC 2 cut(s) 87, 190
BspCNI CTCAG 2 cut(s) 201, 211
BspLI GGNNCC 2 cut(s) 77, 180
BspT104I TTCGAA 2 cut(s) 45, 156
BsrI ACTGG 1 cut(s) 234
BssMI GATC 2 cut(s) 14, 125
BstBI TTCGAA 2 cut(s) 45, 156
BstDEI CTNAG 2 cut(s) 209, 219
BstKTI GATC 2 cut(s) 17, 128
BstMBI GATC 2 cut(s) 14, 125
BstMWI GCNNNNNNNGC 5 cut(s) 17, 26, 84, 128, 187
BsuRI GGCC 2 cut(s) 87, 190
DdeI CTNAG 2 cut(s) 209, 219
DpnI GATC 2 cut(s) 16, 127
DpnII GATC 2 cut(s) 14, 125
EciI GGCGGA 7 cut(s) 35, 72, 80, 88, 146, 183, 191
Eco147I AGGCCT 2 cut(s) 87, 190
Eco24I GRGCYC 1 cut(s) 96
Eco88I CYCGRG 3 cut(s) 89, 97, 192
EcoT38I GRGCYC 1 cut(s) 96
FriOI GRGCYC 1 cut(s) 96
GsaI CCCAGC 1 cut(s) 33
HaeIII GGCC 2 cut(s) 87, 190
HpyAV CCTTC 6 cut(s) 41, 52, 89, 152, 163, 192
HpyCH4V TGCA 2 cut(s) 11, 122
HpyF10VI GCNNNNNNNGC 5 cut(s) 17, 26, 84, 128, 187
HpyF3I CTNAG 2 cut(s) 209, 219
Kzo9I GATC 2 cut(s) 14, 125
LmnI GCTCC 2 cut(s) 75, 178
LpnPI CCDG 3 cut(s) 15, 126, 215
MalI GATC 2 cut(s) 16, 127
MboI GATC 2 cut(s) 14, 125
MhlI GDGCHC 1 cut(s) 96
MwoI GCNNNNNNNGC 5 cut(s) 17, 26, 84, 128, 187
NdeII GATC 2 cut(s) 14, 125
NlaIV GGNNCC 2 cut(s) 77, 180
NspV TTCGAA 2 cut(s) 45, 156
PaeR7I CTCGAG 3 cut(s) 89, 97, 192
PceI AGGCCT 2 cut(s) 87, 190
PspFI CCCAGC 1 cut(s) 29
PspN4I GGNNCC 2 cut(s) 77, 180
PspXI VCTCGAGB 3 cut(s) 89, 97, 192
Sau3AI GATC 2 cut(s) 14, 125
SduI GDGCHC 1 cut(s) 96
Sfr274I CTCGAG 3 cut(s) 89, 97, 192
SfuI TTCGAA 2 cut(s) 45, 156
SlaI CTCGAG 3 cut(s) 89, 97, 192
SmlI CTYRAG 3 cut(s) 89, 97, 192
SmoI CTYRAG 3 cut(s) 89, 97, 192
SseBI AGGCCT 2 cut(s) 87, 190
SsiI CCGC 7 cut(s) 20, 57, 65, 73, 131, 168, 176
StuI AGGCCT 2 cut(s) 87, 190
TaqI TCGA 9 cut(s) 37, 45, 82, 90, 98, 148, 156, 185, 193
XhoI CTCGAG 3 cut(s) 89, 97, 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.