Rmu_sc0000116.1_g000001

The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000116.1
OG0011894
Physical Location & Seq
Reverse (-)
522 .. 4946
4425 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000116.1_g000001.1.cds

Sequence Viewer

Length: 903 bp
atgtatacatatttggaggaagattccgtaaggcattctaaggacgataacggaggaggactaaggcaaagcaaaaacccttcttctccaacacgaaaaccatctcataaaatcagtagagacctcatcgctcccgacccaaatcaaatttctcctcagatcaatctccagggtttcgtatcaaccaagatgtttctcacaagaactgagtatgacagaggagtaaacactttctccccagaaggtagactttttcaggttgaatatgccattgaggccattaagctcggttcgactgctattgggttgaagacaaaagaaggtgttgtgcttgctgtggagaagcgtatcacttcgcctttgctggaacccagcagtgtggagaaaattatggaaattgatgaccatattggatgtgccatgagtggattgattgctgatgctcgtacacttgttgaacatgcacgagtggaaactcagaaccacaggttctcctatggtgagccaatgaccgtggagtctacaacgcaagcactttgtgatctggcactacgatttggtgaaggtgatgaagagtccatgtctcggccatttggggtatctcttctcattgcaggtcatgatgagcatgggcccagcttatactatactgatccatctggcacattttggcaatgcaatgcaaaagctataggttcgggttcagaaggtgcagacagctctctgcaagagcaatacagcaaggacttgactcttaaagaagctgagacaattgctctttccattcttaagcaagtcatggaggaaaaggtgactcccaataatgttgatattgcaaaggtttcgcccacatatcatctatataccccttctgaggtggaggaggtcatcagtcgcctatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0000502 GO:0005575 GO:0005622 GO:0005623 GO:0005839 GO:0019773 GO:0032991 GO:0044424 GO:0044464 GO:1902494 GO:1905368 GO:1905369
KEGG Pathways
Metabolic & Signaling
ko03050 map03050
Pfam Domains
Protein Families
Proteasome Proteasome_A_N

Protein Analysis

300

Amino Acids

33.09

Weight (kDa)

5.07

Isoelectric Point (pI)

51.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011894)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G53850 AT1G53850 AT3G14290
fragaria_vesca FvH4_3g12370
malus_domestica MD05G1251400.v1.1 MD10G1231900.v1.1
prunus_persica Prupe.4G112400_v2.0.a1 Prupe.4G112400_v2.0.a1
pyrus_communis pycom10g19520
rosa_chinensis RchiOBHm_Chr5g0020181
rosa_laevigata RLG00000032507
rosa_multiflora Rmu_sc0000116.1_g000001
rosa_roxburghii Rroxscaffold_1G00058020
rosa_rugosa Rorug05G0057500
rosa_samantha Rh5AG147900 Rh5BG147500 Rh5CG158900 Rh5DG146600
rosa_wichuraiana Rw5G013080

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 517
Acc36I ACCTGC 1 cut(s) 605
AccI GTMKAC 3 cut(s) 5, 247, 521
AclWI GGATC 1 cut(s) 647
AcoI YGGCCR 1 cut(s) 587
AcsI RAATTY 1 cut(s) 147
AdeI CACNNNGTG 1 cut(s) 539
AfaI GTAC 1 cut(s) 448
AfiI CCNNNNNNNGG 2 cut(s) 585, 874
AflII CTTAAG 1 cut(s) 788
AgsI TTSAA 3 cut(s) 263, 310, 458
AjnI CCWGG 1 cut(s) 168
AjuI GAANNNNNNNTTGG 2 cut(s) 133, 165
AluBI AGCT 5 cut(s) 286, 639, 689, 720, 764
AluI AGCT 5 cut(s) 286, 639, 689, 720, 764
Alw26I GTCTC 3 cut(s) 114, 588, 761
AlwI GGATC 1 cut(s) 647
AoxI GGCC 3 cut(s) 276, 587, 632
ApaI GGGCCC 1 cut(s) 636
ApoI RAATTY 1 cut(s) 147
AspS9I GGNCC 2 cut(s) 632, 633
AsuHPI GGTGA 4 cut(s) 512, 572, 578, 823
BaeGI GKGCMC 1 cut(s) 636
BanII GRGCYC 1 cut(s) 636
BauI CACGAG 1 cut(s) 465
BbsI GAAGAC 1 cut(s) 317
BccI CCATC 2 cut(s) 109, 664
BcgI CGANNNNNNTGC 2 cut(s) 825, 859
BciT130I CCWGG 1 cut(s) 170
BcoDI GTCTC 3 cut(s) 114, 588, 761
BfmI CTRYAG 1 cut(s) 690
BfrI CTTAAG 1 cut(s) 788
BfuAI ACCTGC 1 cut(s) 605
BglI GCCNNNNNGGC 1 cut(s) 275
Bme1390I CCNGG 1 cut(s) 170
BmgT120I GGNCC 2 cut(s) 632, 633
BmiI GGNNCC 2 cut(s) 369, 634
BmrFI CCNGG 1 cut(s) 170
BmsI GCATC 1 cut(s) 430
BpiI GAAGAC 1 cut(s) 317
BpmI CTGGAG 1 cut(s) 152
BsaI GGTCTC 1 cut(s) 114
BsaJI CCNNGG 2 cut(s) 169, 513
BsaXI ACNNNNNCTCC 4 cut(s) 218, 248, 476, 506
Bsc4I CCNNNNNNNGG 2 cut(s) 585, 874
Bse3DI GCAATG 3 cut(s) 609, 680, 685
BseBI CCWGG 1 cut(s) 170
BseDI CCNNGG 2 cut(s) 169, 513
BseGI GGATG 1 cut(s) 419
BseLI CCNNNNNNNGG 2 cut(s) 585, 874
BseMI GCAATG 3 cut(s) 609, 680, 685
BseMII CTCAG 5 cut(s) 170, 198, 491, 756, 864
BseRI GAGGAG 4 cut(s) 69, 144, 234, 896
BseSI GKGCMC 1 cut(s) 636
BseYI CCCAGC 2 cut(s) 371, 635
BsgI GTGCAG 1 cut(s) 732
BshFI GGCC 3 cut(s) 278, 589, 634
BslI CCNNNNNNNGG 2 cut(s) 585, 874
BsmAI GTCTC 3 cut(s) 114, 588, 761
BsmI GAATGC 1 cut(s) 34
BsnI GGCC 3 cut(s) 278, 589, 634
Bso31I GGTCTC 1 cut(s) 114
Bsp120I GGGCCC 1 cut(s) 632
Bsp1286I GDGCHC 1 cut(s) 636
Bsp143I GATC 3 cut(s) 159, 541, 652
BspANI GGCC 3 cut(s) 278, 589, 634
BspCNI CTCAG 5 cut(s) 169, 199, 490, 757, 865
BspHI TCATGA 1 cut(s) 619
BspLI GGNNCC 2 cut(s) 369, 634
BspMI ACCTGC 1 cut(s) 605
BspPI GGATC 1 cut(s) 647
BspTI CTTAAG 1 cut(s) 788
BspTNI GGTCTC 1 cut(s) 114
BsrDI GCAATG 3 cut(s) 609, 680, 685
BssECI CCNNGG 2 cut(s) 169, 513
BssMI GATC 3 cut(s) 159, 541, 652
BssNAI GTATAC 1 cut(s) 6
BssSI CACGAG 1 cut(s) 465
Bst1107I GTATAC 1 cut(s) 6
Bst2BI CACGAG 1 cut(s) 465
Bst2UI CCWGG 1 cut(s) 170
Bst4CI ACNGT 1 cut(s) 514
Bst6I CTCTTC 2 cut(s) 567, 609
BstAFI CTTAAG 1 cut(s) 788
BstC8I GCNNGC 2 cut(s) 333, 531
BstDEI CTNAG 7 cut(s) 39, 62, 156, 207, 477, 765, 873
BstDSI CCRYGG 1 cut(s) 513
BstF5I GGATG 1 cut(s) 419
BstKTI GATC 3 cut(s) 162, 544, 655
BstMAI GTCTC 3 cut(s) 114, 588, 761
BstMBI GATC 3 cut(s) 159, 541, 652
BstMWI GCNNNNNNNGC 1 cut(s) 275
BstNI CCWGG 1 cut(s) 170
BstNSI RCATGY 1 cut(s) 464
BstSCI CCNGG 1 cut(s) 168
BstSFI CTRYAG 1 cut(s) 690
BstSLI GKGCMC 1 cut(s) 636
BstV2I GAAGAC 1 cut(s) 317
BstXI CCANNNNNNTGG 1 cut(s) 379
BstZ17I GTATAC 1 cut(s) 6
BsuRI GGCC 3 cut(s) 278, 589, 634
BtgI CCRYGG 1 cut(s) 513
BtgZI GCGATG 1 cut(s) 112
BtsCI GGATG 1 cut(s) 419
BtsI GCAGTG 1 cut(s) 382
BtsIMutI CAGTG 1 cut(s) 382
BveI ACCTGC 1 cut(s) 605
Cac8I GCNNGC 2 cut(s) 333, 531
CciI TCATGA 1 cut(s) 619
Cfr13I GGNCC 2 cut(s) 632, 633
Csp6I GTAC 1 cut(s) 447
CspCI CAANNNNNGTGG 2 cut(s) 495, 530
CviAII CATG 6 cut(s) 421, 461, 580, 620, 629, 799
CviJI RGCY 9 cut(s) 278, 286, 505, 589, 634, 639, 689, 720, 764
CviKI_1 RGCY 9 cut(s) 278, 286, 505, 589, 634, 639, 689, 720, 764
CviQI GTAC 1 cut(s) 447
DdeI CTNAG 7 cut(s) 39, 62, 156, 207, 477, 765, 873
DpnI GATC 3 cut(s) 161, 543, 654
DpnII GATC 3 cut(s) 159, 541, 652
DraIII CACNNNGTG 1 cut(s) 539
DrdI GACNNNNNNGTC 1 cut(s) 517
DseDI GACNNNNNNGTC 1 cut(s) 517
EaeI YGGCCR 1 cut(s) 587
Eam1104I CTCTTC 2 cut(s) 567, 609
EarI CTCTTC 2 cut(s) 567, 609
Eco24I GRGCYC 1 cut(s) 636
Eco31I GGTCTC 1 cut(s) 114
EcoRII CCWGG 1 cut(s) 168
EcoT38I GRGCYC 1 cut(s) 636
FaeI CATG 6 cut(s) 424, 464, 583, 623, 632, 802
FalI AAGNNNNNCTT 2 cut(s) 234, 266
FatI CATG 6 cut(s) 420, 460, 579, 619, 628, 798
FblI GTMKAC 3 cut(s) 5, 247, 521
FokI GGATG 1 cut(s) 426
FriOI GRGCYC 1 cut(s) 636
GsaI CCCAGC 2 cut(s) 375, 639
GsuI CTGGAG 1 cut(s) 152
HaeIII GGCC 3 cut(s) 278, 589, 634
Hin1II CATG 6 cut(s) 424, 464, 583, 623, 632, 802
HinfI GANTC 5 cut(s) 23, 518, 575, 751, 814
HphI GGTGA 4 cut(s) 512, 572, 578, 823
Hpy166II GTNNAC 5 cut(s) 6, 226, 248, 449, 522
Hpy188I TCNGA 4 cut(s) 159, 480, 706, 874
Hpy188III TCNNGA 2 cut(s) 134, 620
Hpy8I GTNNAC 5 cut(s) 6, 226, 248, 449, 522
HpyAV CCTTC 6 cut(s) 90, 236, 314, 557, 701, 879
HpyCH4III ACNGT 1 cut(s) 514
HpyCH4V TGCA 7 cut(s) 464, 614, 678, 683, 713, 727, 836
HpyF10VI GCNNNNNNNGC 1 cut(s) 275
HpyF3I CTNAG 7 cut(s) 39, 62, 156, 207, 477, 765, 873
Hsp92II CATG 6 cut(s) 424, 464, 583, 623, 632, 802
Kzo9I GATC 3 cut(s) 159, 541, 652
LmnI GCTCC 1 cut(s) 136
LweI GCATC 1 cut(s) 430
MaeIII GTNAC 1 cut(s) 811
MalI GATC 3 cut(s) 161, 543, 654
MboI GATC 3 cut(s) 159, 541, 652
MboII GAAGA 5 cut(s) 32, 75, 322, 584, 596
MfeI CAATTG 1 cut(s) 771
MhlI GDGCHC 1 cut(s) 636
MluCI AATT 4 cut(s) 147, 387, 396, 771
MlyI GAGTC 4 cut(s) 527, 584, 745, 808
MmeI TCCRAC 1 cut(s) 113
MseI TTAA 3 cut(s) 282, 756, 789
MspCI CTTAAG 1 cut(s) 788
MspR9I CCNGG 1 cut(s) 170
MunI CAATTG 1 cut(s) 771
Mva1269I GAATGC 1 cut(s) 34
MvaI CCWGG 1 cut(s) 170
MwoI GCNNNNNNNGC 1 cut(s) 275
NdeII GATC 3 cut(s) 159, 541, 652
NlaIII CATG 6 cut(s) 424, 464, 583, 623, 632, 802
NlaIV GGNNCC 2 cut(s) 369, 634
NmeAIII GCCGAG 1 cut(s) 565
NmuCI GTSAC 1 cut(s) 811
NspI RCATGY 1 cut(s) 464
PagI TCATGA 1 cut(s) 619
PctI GAATGC 1 cut(s) 34
PfeI GAWTC 1 cut(s) 23
PleI GAGTC 4 cut(s) 526, 583, 745, 808
PpsI GAGTC 4 cut(s) 526, 583, 745, 808
Psp6I CCWGG 1 cut(s) 168
PspFI CCCAGC 2 cut(s) 371, 635
PspGI CCWGG 1 cut(s) 168
PspN4I GGNNCC 2 cut(s) 369, 634
PspOMI GGGCCC 1 cut(s) 632
PspPI GGNCC 2 cut(s) 632, 633
RsaI GTAC 1 cut(s) 448
RsaNI GTAC 1 cut(s) 447
SaqAI TTAA 3 cut(s) 282, 756, 789
Sau3AI GATC 3 cut(s) 159, 541, 652
Sau96I GGNCC 2 cut(s) 632, 633
SchI GAGTC 4 cut(s) 527, 584, 745, 808
ScrFI CCNGG 1 cut(s) 170
SduI GDGCHC 1 cut(s) 636
SfaNI GCATC 1 cut(s) 430
SfcI CTRYAG 1 cut(s) 690
SmlI CTYRAG 1 cut(s) 788
SmoI CTYRAG 1 cut(s) 788
Sse9I AATT 4 cut(s) 147, 387, 396, 771
StyD4I CCNGG 1 cut(s) 168
TaaI ACNGT 1 cut(s) 514
TaqI TCGA 1 cut(s) 293
TasI AATT 4 cut(s) 147, 387, 396, 771
TfiI GAWTC 1 cut(s) 23
Tru1I TTAA 3 cut(s) 282, 756, 789
Tru9I TTAA 3 cut(s) 282, 756, 789
TscAI CASTG 1 cut(s) 382
TseFI GTSAC 1 cut(s) 811
Tsp45I GTSAC 1 cut(s) 811
TspDTI ATGAA 1 cut(s) 585
TspGWI ACGGA 2 cut(s) 16, 66
TspRI CASTG 1 cut(s) 382
Vha464I CTTAAG 1 cut(s) 788
XapI RAATTY 1 cut(s) 147
XceI RCATGY 1 cut(s) 464
XmiI GTMKAC 3 cut(s) 5, 247, 521
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.