Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000127.1

Orthogroup ID

OG0018570

Physical Location & Seq

Genomic Coordinates Forward (+)

20055 .. 20899

Gene Structure 845 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000127.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 315 bp

atgttcaatggaacatttcagagcgagattgacaacttgtccaatctcgagatcctagacatgtccttcaatggtgatttgatcgctgtagcaatcccacaggagttcaaaaagttggagaagctaaagaaaattctagatgaggctatcaaatttggtcggttagatcctggagacatttgtaacttggcaagaccgggaaggttgcttcccaacgaggtcttggccgctttcgactactacggggtaggttgtatgtcgggctatggcatgcatgttgtggttgggccccaccatggcttgtgggcctcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_6 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

104

Amino Acids

11.48

Weight (kDa)

5.19

Isoelectric Point (pI)

37.69

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018570)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0111621
rosa_laevigata	RLG00000003499
rosa_multiflora	Rmu_sc0000127.1_g000005
rosa_roxburghii	Rroxscaffold_5G00379740 Rroxscaffold_6G00390630
rosa_samantha	Rh2AG362300 Rh2CG243900 Rh5AG250400 Rh5DG449100 Rh6CG246200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	228
AclWI	GGATC	2 cut(s)	46, 161
AcoI	YGGCCR	1 cut(s)	225
AcsI	RAATTY	2 cut(s)	132, 152
AfiI	CCNNNNNNNGG	1 cut(s)	296
AflIII	ACRYGT	1 cut(s)	60
AgsI	TTSAA	3 cut(s)	7, 70, 109
AhdI	GACNNNNNGTC	1 cut(s)	37
AjnI	CCWGG	1 cut(s)	169
AluBI	AGCT	1 cut(s)	124
AluI	AGCT	1 cut(s)	124
Alw26I	GTCTC	1 cut(s)	168
AlwI	GGATC	2 cut(s)	46, 161
Ama87I	CYCGRG	1 cut(s)	47
AoxI	GGCC	3 cut(s)	225, 287, 306
ApaI	GGGCCC	1 cut(s)	291
ApoI	RAATTY	2 cut(s)	132, 152
AspS9I	GGNCC	3 cut(s)	287, 288, 306
AsuC2I	CCSGG	1 cut(s)	198
AsuHPI	GGTGA	1 cut(s)	86
AvaI	CYCGRG	1 cut(s)	47
BaeGI	GKGCMC	1 cut(s)	291
BanII	GRGCYC	1 cut(s)	291
BciT130I	CCWGG	1 cut(s)	171
BcnI	CCSGG	1 cut(s)	198
BcoDI	GTCTC	1 cut(s)	168
BfaI	CTAG	2 cut(s)	56, 137
BfmI	CTRYAG	1 cut(s)	87
BisI	GCNGC	1 cut(s)	228
BlsI	GCNGC	1 cut(s)	229
Bme1390I	CCNGG	2 cut(s)	171, 198
BmeRI	GACNNNNNGTC	1 cut(s)	37
BmeT110I	CYCGRG	1 cut(s)	47
BmgT120I	GGNCC	3 cut(s)	287, 288, 306
BmiI	GGNNCC	2 cut(s)	289, 290
BmrFI	CCNGG	2 cut(s)	171, 198
BpmI	CTGGAG	1 cut(s)	192
BpuMI	CCSGG	1 cut(s)	198
BsaJI	CCNNGG	1 cut(s)	295
Bsc4I	CCNNNNNNNGG	1 cut(s)	296
BseBI	CCWGG	1 cut(s)	171
BseDI	CCNNGG	1 cut(s)	295
BseLI	CCNNNNNNNGG	1 cut(s)	296
BseSI	GKGCMC	1 cut(s)	291
BshFI	GGCC	3 cut(s)	227, 289, 308
BsiHKCI	CYCGRG	1 cut(s)	47
BsiSI	CCGG	1 cut(s)	197
BslI	CCNNNNNNNGG	1 cut(s)	296
BsmAI	GTCTC	1 cut(s)	168
BsnI	GGCC	3 cut(s)	227, 289, 308
BsoBI	CYCGRG	1 cut(s)	47
Bsp120I	GGGCCC	1 cut(s)	287
Bsp1286I	GDGCHC	1 cut(s)	291
Bsp143I	GATC	3 cut(s)	51, 81, 166
Bsp19I	CCATGG	1 cut(s)	295
BspACI	CCGC	1 cut(s)	228
BspANI	GGCC	3 cut(s)	227, 289, 308
BspLI	GGNNCC	2 cut(s)	289, 290
BspPI	GGATC	2 cut(s)	46, 161
BssECI	CCNNGG	1 cut(s)	295
BssMI	GATC	3 cut(s)	51, 81, 166
BssT1I	CCWWGG	1 cut(s)	295
Bst2UI	CCWGG	1 cut(s)	171
BstC8I	GCNNGC	1 cut(s)	272
BstDSI	CCRYGG	1 cut(s)	295
BstKTI	GATC	3 cut(s)	54, 84, 169
BstMAI	GTCTC	1 cut(s)	168
BstMBI	GATC	3 cut(s)	51, 81, 166
BstNI	CCWGG	1 cut(s)	171
BstNSI	RCATGY	3 cut(s)	64, 274, 278
BstSCI	CCNGG	2 cut(s)	169, 196
BstSFI	CTRYAG	1 cut(s)	87
BstSLI	GKGCMC	1 cut(s)	291
BstX2I	RGATCY	2 cut(s)	51, 166
BstYI	RGATCY	2 cut(s)	51, 166
BsuRI	GGCC	3 cut(s)	227, 289, 308
BtgI	CCRYGG	1 cut(s)	295
Cac8I	GCNNGC	1 cut(s)	272
Cfr13I	GGNCC	3 cut(s)	287, 288, 306
CviAII	CATG	4 cut(s)	61, 271, 275, 296
CviJI	RGCY	7 cut(s)	124, 146, 227, 264, 289, 300, 308
CviKI_1	RGCY	7 cut(s)	124, 146, 227, 264, 289, 300, 308
DpnI	GATC	3 cut(s)	53, 83, 168
DpnII	GATC	3 cut(s)	51, 81, 166
DriI	GACNNNNNGTC	1 cut(s)	37
EaeI	YGGCCR	1 cut(s)	225
Eam1105I	GACNNNNNGTC	1 cut(s)	37
Eco130I	CCWWGG	1 cut(s)	295
Eco24I	GRGCYC	1 cut(s)	291
Eco88I	CYCGRG	1 cut(s)	47
EcoO109I	RGGNCCY	1 cut(s)	288
EcoRII	CCWGG	1 cut(s)	169
EcoT14I	CCWWGG	1 cut(s)	295
EcoT22I	ATGCAT	1 cut(s)	276
EcoT38I	GRGCYC	1 cut(s)	291
ErhI	CCWWGG	1 cut(s)	295
FaeI	CATG	4 cut(s)	64, 274, 278, 299
FaiI	YATR	6 cut(s)	62, 257, 267, 272, 276, 297
FatI	CATG	4 cut(s)	60, 270, 274, 295
Fnu4HI	GCNGC	1 cut(s)	228
FriOI	GRGCYC	1 cut(s)	291
Fsp4HI	GCNGC	1 cut(s)	228
FspBI	CTAG	2 cut(s)	56, 137
GluI	GCNGC	1 cut(s)	228
GsuI	CTGGAG	1 cut(s)	192
HaeIII	GGCC	3 cut(s)	227, 289, 308
HapII	CCGG	1 cut(s)	197
Hin1II	CATG	4 cut(s)	64, 274, 278, 299
HpaII	CCGG	1 cut(s)	197
HphI	GGTGA	1 cut(s)	86
Hpy188I	TCNGA	1 cut(s)	21
Hpy188III	TCNNGA	3 cut(s)	47, 49, 137
HpyAV	CCTTC	2 cut(s)	76, 195
HpyCH4V	TGCA	1 cut(s)	274
Hsp92II	CATG	4 cut(s)	64, 274, 278, 299
Kzo9I	GATC	3 cut(s)	51, 81, 166
LpnPI	CCDG	4 cut(s)	86, 156, 183, 210
MaeI	CTAG	2 cut(s)	56, 137
MaeIII	GTNAC	1 cut(s)	182
MalI	GATC	3 cut(s)	53, 83, 168
MboI	GATC	3 cut(s)	51, 81, 166
MflI	RGATCY	2 cut(s)	51, 166
MhlI	GDGCHC	1 cut(s)	291
MluCI	AATT	2 cut(s)	132, 152
MmeI	TCCRAC	1 cut(s)	96
MnlI	CCTC	2 cut(s)	136, 211
Mph1103I	ATGCAT	1 cut(s)	276
MseI	TTAA	1 cut(s)	313
MspI	CCGG	1 cut(s)	197
MspR9I	CCNGG	2 cut(s)	171, 198
MvaI	CCWGG	1 cut(s)	171
NciI	CCSGG	1 cut(s)	198
NcoI	CCATGG	1 cut(s)	295
NdeII	GATC	3 cut(s)	51, 81, 166
NlaIII	CATG	4 cut(s)	64, 274, 278, 299
NlaIV	GGNNCC	2 cut(s)	289, 290
NsiI	ATGCAT	1 cut(s)	276
NspI	RCATGY	3 cut(s)	64, 274, 278
PaeI	GCATGC	1 cut(s)	274
PaeR7I	CTCGAG	1 cut(s)	47
PciI	ACATGT	1 cut(s)	60
PfoI	TCCNGGA	1 cut(s)	169
PkrI	GCNGC	1 cut(s)	229
PscI	ACATGT	1 cut(s)	60
Psp6I	CCWGG	1 cut(s)	169
PspGI	CCWGG	1 cut(s)	169
PspN4I	GGNNCC	2 cut(s)	289, 290
PspOMI	GGGCCC	1 cut(s)	287
PspPI	GGNCC	3 cut(s)	287, 288, 306
PsuI	RGATCY	2 cut(s)	51, 166
SaqAI	TTAA	1 cut(s)	313
SatI	GCNGC	1 cut(s)	228
Sau3AI	GATC	3 cut(s)	51, 81, 166
Sau96I	GGNCC	3 cut(s)	287, 288, 306
ScrFI	CCNGG	2 cut(s)	171, 198
SduI	GDGCHC	1 cut(s)	291
SetI	ASST	4 cut(s)	126, 206, 222, 253
SfcI	CTRYAG	1 cut(s)	87
Sfr274I	CTCGAG	1 cut(s)	47
SlaI	CTCGAG	1 cut(s)	47
SmlI	CTYRAG	1 cut(s)	47
SmoI	CTYRAG	1 cut(s)	47
SphI	GCATGC	1 cut(s)	274
Sse9I	AATT	2 cut(s)	132, 152
SsiI	CCGC	1 cut(s)	228
SspMI	CTAG	2 cut(s)	56, 137
StyD4I	CCNGG	2 cut(s)	169, 196
StyI	CCWWGG	1 cut(s)	295
TaqI	TCGA	2 cut(s)	48, 234
TasI	AATT	2 cut(s)	132, 152
TauI	GCSGC	1 cut(s)	230
Tru1I	TTAA	1 cut(s)	313
Tru9I	TTAA	1 cut(s)	313
XapI	RAATTY	2 cut(s)	132, 152
XbaI	TCTAGA	1 cut(s)	136
XceI	RCATGY	3 cut(s)	64, 274, 278
XcmI	CCANNNNNNNNNTGG	1 cut(s)	220
XhoI	CTCGAG	1 cut(s)	47
XspI	CTAG	2 cut(s)	56, 137
Zsp2I	ATGCAT	1 cut(s)	276

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.