Rh2AG362300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
53702734 .. 53702889
156 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG362300.1

Sequence Viewer

Length: 156 bp
ATGTCCTTCAATGGTGATCTAATCGCTGTAGCAATCCCATCGGAGTTCAAAAAGTTGGAGAAGCTAAAGAAAATTCTAGATGAGGCTATCAAATTTGGTCGGTTAGATCCTGGAGACAATTGTGAGATTGTGATTCCAGAGCAGCTGAGATTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.76

Weight (kDa)

5.21

Isoelectric Point (pI)

26.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018570)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 101
AcsI RAATTY 2 cut(s) 72, 92
AgsI TTSAA 2 cut(s) 10, 49
AjnI CCWGG 1 cut(s) 109
AluBI AGCT 2 cut(s) 64, 145
AluI AGCT 2 cut(s) 64, 145
Alw26I GTCTC 1 cut(s) 108
AlwI GGATC 1 cut(s) 101
ApeKI GCWGC 1 cut(s) 142
ApoI RAATTY 2 cut(s) 72, 92
AsuHPI GGTGA 1 cut(s) 26
BccI CCATC 1 cut(s) 46
BcgI CGANNNNNNTGC 2 cut(s) 21, 55
BciT130I CCWGG 1 cut(s) 111
BcoDI GTCTC 1 cut(s) 108
BfaI CTAG 1 cut(s) 77
BfmI CTRYAG 1 cut(s) 27
BisI GCNGC 1 cut(s) 143
BlsI GCNGC 1 cut(s) 144
Bme1390I CCNGG 1 cut(s) 111
BmrFI CCNGG 1 cut(s) 111
BpmI CTGGAG 1 cut(s) 132
BseBI CCWGG 1 cut(s) 111
BseMII CTCAG 1 cut(s) 137
BsmAI GTCTC 1 cut(s) 108
Bsp143I GATC 2 cut(s) 16, 106
BspCNI CTCAG 1 cut(s) 138
BspPI GGATC 1 cut(s) 101
BssMI GATC 2 cut(s) 16, 106
Bst2UI CCWGG 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 146
BstKTI GATC 2 cut(s) 19, 109
BstMAI GTCTC 1 cut(s) 108
BstMBI GATC 2 cut(s) 16, 106
BstNI CCWGG 1 cut(s) 111
BstSCI CCNGG 1 cut(s) 109
BstSFI CTRYAG 1 cut(s) 27
BstX2I RGATCY 1 cut(s) 106
BstYI RGATCY 1 cut(s) 106
CviJI RGCY 3 cut(s) 64, 86, 145
CviKI_1 RGCY 3 cut(s) 64, 86, 145
DdeI CTNAG 1 cut(s) 146
DpnI GATC 2 cut(s) 18, 108
DpnII GATC 2 cut(s) 16, 106
EcoRII CCWGG 1 cut(s) 109
Fnu4HI GCNGC 1 cut(s) 143
Fsp4HI GCNGC 1 cut(s) 143
FspBI CTAG 1 cut(s) 77
GluI GCNGC 1 cut(s) 143
GsuI CTGGAG 1 cut(s) 132
HinfI GANTC 1 cut(s) 133
HphI GGTGA 1 cut(s) 26
Hpy188I TCNGA 1 cut(s) 43
Hpy188III TCNNGA 2 cut(s) 77, 137
HpyAV CCTTC 1 cut(s) 16
HpyF3I CTNAG 1 cut(s) 146
Kzo9I GATC 2 cut(s) 16, 106
LpnPI CCDG 3 cut(s) 96, 123, 150
MaeI CTAG 1 cut(s) 77
MalI GATC 2 cut(s) 18, 108
MboI GATC 2 cut(s) 16, 106
MfeI CAATTG 1 cut(s) 118
MflI RGATCY 1 cut(s) 106
MluCI AATT 3 cut(s) 72, 92, 118
MmeI TCCRAC 1 cut(s) 36
MnlI CCTC 1 cut(s) 76
MspA1I CMGCKG 1 cut(s) 145
MspR9I CCNGG 1 cut(s) 111
MunI CAATTG 1 cut(s) 118
MvaI CCWGG 1 cut(s) 111
NdeII GATC 2 cut(s) 16, 106
PfeI GAWTC 1 cut(s) 133
PfoI TCCNGGA 1 cut(s) 109
PkrI GCNGC 1 cut(s) 144
Psp6I CCWGG 1 cut(s) 109
PspGI CCWGG 1 cut(s) 109
PsuI RGATCY 1 cut(s) 106
PvuII CAGCTG 1 cut(s) 145
SatI GCNGC 1 cut(s) 143
Sau3AI GATC 2 cut(s) 16, 106
ScrFI CCNGG 1 cut(s) 111
SetI ASST 2 cut(s) 66, 147
SfcI CTRYAG 1 cut(s) 27
SgeI CNNG 4 cut(s) 89, 122, 123, 149
Sse9I AATT 3 cut(s) 72, 92, 118
SspMI CTAG 1 cut(s) 77
StyD4I CCNGG 1 cut(s) 109
TasI AATT 3 cut(s) 72, 92, 118
TfiI GAWTC 1 cut(s) 133
TseI GCWGC 1 cut(s) 142
XapI RAATTY 2 cut(s) 72, 92
XbaI TCTAGA 1 cut(s) 76
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.