Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000441.1

Orthogroup ID

OG0009540

Physical Location & Seq

Genomic Coordinates Reverse (-)

465776 .. 474116

Gene Structure 8341 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000441.1_g000128.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 3465 bp

atgcccaaacccgagacccagagttctaggcgatcccgtccgtcgcctctgagagaacggaagcgagtgatggaggaccgatcaagaactgggttgcacgattttactagggcttcaagaaaggctgaagaatcagcctggaggcgatttcaagcagttgagtggcttgagagctttgtgggtccacttggcataccgaaccagccatcggagaaggacttcatttcttgcctgagaaatggtctcatcctatgcaacgccataaacaagattcaacccggatcagtgcccagggtggtggagagccaaatgcctttacaatcactaagcagggaatctcaaccattgcctgcatatcagtactttgagaatgtccgaaactttctggttgctgctgaagagttaaagctgcctgcttttgaagcctctgaccttgaaagggatacattggacgcagggtcagcagggaaggttgttgattgtgttttagcccttagatcctataatgagtggaagcagatgagcaatgggaatggatgttataaacatataaaatctcccttagttatgcattctgccaatagaatgcattcaagacccccagctatggtctcctcgcactcttgcaggaacttggatatgtctgctggacttgatagacaactatcgatcgaggatgacaaacggaaacctgaagtggattctatagaatctgttgtcaagttaattgctacttctatggttgacttaaaggaaaacattgatgataaccttcttgcttcctaccataacggagatctggatgctgttagtgtctttagaaggatcatgacaagttgtctagaggaacattttcaaaagaagttacctgagttggagtgtacgttaagagaatcctccaatggaagaagcagctcacctgcacattcaacatctattcctctagaggatatatctgcctttgaaaattcaagttgctgcaaagcttgtttgagaaagggtaactgcaaccaccggcttctatttcaattgcaagagaaagaattagtggatctaaaggcattgtggttaagtgcaaaaacagagttcgaagacctacaatcccagctgcacagtgatttgaaagacttggggacacaggtacaagagctgtctactgctgctcttggctatcataaggtggtgcaagagaatagaaaactgtacaacatggttcaggatttgaaaggtaatattagagtctactgcaggattaggccgtccttcaattgtgaatcccaaaacattatagatttcattggaggggatggatcacttgtgatcttggaccctgcaaagccccaaaaggatggaaggaaagtttttcagttcaatcaagtgtttggtccagctgctacccaagatgaggttttcaaggacactcaacctttgatcaggtctgtgatggatggctacaatgtatgcatatttgcttatggtcaaactggatcaggcaaaacacataccatgagtggtccatctggtgggtcaactagcgacatggggattaattatctagctctcaacgatctcttccagatgtcaaaaagaaggaaggatatcatacattatgacattcatgttcaaatggttgaaatttacaatgaacaagtacgagatcttcttgtacaagattcatctactgtcaaatatcctttcatattggttatttatcttactttaaacatttattttattggaaagaaaaactggccacgttcattttgtgtatccttaacaattcacaaattagagatccggagctgcaccggtgataatggcttgagtattccagatgctacaatgcattcagtgaattcaaccactgatgttcttaacctcatgaaatacggtgaggtgaatcgagttgtcagtactactgcaatgaataaccgcagtagccgttcccatagtgtcctgactgtccatgtgcatggaaaagatacaactggaggtactttccacagttgccttcatttagttgacctggcaggaagtgaacgggtggacaaatctgaagttacaggagacaggctcaaagaggcacagtatatcaacaagtctctttcttgtttaggagatgttattacagccttggcccagaagaattctcacatcccttacagaaacagcaaactcacacttttgttgcaaggctccttaggtggacatgctaaaactttaatgcttgctcatgtgagtccagaagaagattctttcagtgaaacggttagtaccttgaagtttgctcagagggtttccactgttgaacttggtgctgctcgtgcaaacaagcagagtggtgaggttatgcaactcaaagaacagattgagagcctgaaaaaggcattagcaaacaaggaagctcagggtatacagttcaacaaaacctgggacaaaccaggagcagtgactgagaggactcctcaatgcaccagaagattaagcattgaaaactgtagtactgcaaagactgagaaagcacagaaccctgaagacagaaagggatcaaaaagtcctttgccaactcgtttaagaagattgagcatggaaggcccaagatctgttaagaaggatggtcttcagatatcacatgacgtggggaaatcctccctaccatctaaggtaatggaggaatatgatcaacttcacggttcagaagcagtcgcaaagccagttgggcatttcagcaatcatgatgccacattggaagtgcatcgtaccaaagctcctcaaagtcccacaagcgtttcctatcagaagcaagtgttagatgctaatagtagaagaccaaaaacacctgaacctcgtcccaggactcctcttagtccaacaagtgttacctatcagaagagagtgtcagaaacagatggtagaaaacaagttcctcttcctcagccaccaacgactcctgagtctcatcccaaggcccctcgaagtccaaggatgactacctatcagaagcaagggacacaaattcctgttctgcggattccatcaacacctgaaccaccaagatttgctacaaatgaggtacagcttgttatggaaagcaagggcagtctttcaacgggttatgtaacacctaatttgacaagtagaacaactggaaaaggatcacagataaggagatccttgcggaccattggaaaactgattaatggctctgagaagaggaaccagcaacctatgatggaaacacattcaacaactaaatgtgcaggcaatttgaatgatgagaaatcacagattactagtagtgcaagaactctgaggcggcaatcattaacaggcattccaacatcaggatctgcccgacgatcctctcttggagggaagccagaagacactagtgtaaatgacaagagagccaaaacacctccacctgtctgcttgtcaacgaaaaataacaagcggtggctttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003774 GO:0003777 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005856 GO:0005871 GO:0005875 GO:0006928 GO:0007017 GO:0007018 GO:0008150 GO:0009987 GO:0015630 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0032991 GO:0043226 GO:0043228 GO:0043229 GO:0043232 GO:0044422 GO:0044424 GO:0044430 GO:0044446 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CH Kinesin Microtub_bd

Protein Analysis

1154

Amino Acids

128.59

Weight (kDa)

9.3

Isoelectric Point (pI)

58.91

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009540)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G10310 AT3G10310
fragaria_vesca	FvH4_6g24140 FvH4_6g24140 FvH4_6g24140 FvH4_6g24140 FvH4_6g24140 FvH4_6g24140 FvH4_6g24140
malus_domestica	MD12G1076000.v1.1 MD14G1074400.v1.1
prunus_persica	Prupe.7G055800_v2.0.a1
pyrus_communis	pycom14g06340
rosa_chinensis	RchiOBHm_Chr3g0483041
rosa_laevigata	RLG00000023304
rosa_multiflora	Rmu_sc0000441.1_g000128
rosa_roxburghii	Rroxscaffold_6G00398680
rosa_rugosa	Rorug03G0204100
rosa_samantha	Rh3AG251900 Rh3CG286100 Rh3DG281700
rosa_wichuraiana	Rw3G022800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	543
AarI	CACCTGC	1 cut(s)	928
AasI	GACNNNNNNGTC	1 cut(s)	2953
Acc36I	ACCTGC	1 cut(s)	928
AccB7I	CCANNNNNTGG	1 cut(s)	1523
AccI	GTMKAC	3 cut(s)	1154, 1242, 2413
AccIII	TCCGGA	1 cut(s)	1797
AciI	CCGC	5 cut(s)	1933, 3028, 3178, 3316, 3454
AcoI	YGGCCR	1 cut(s)	1751
AcsI	RAATTY	5 cut(s)	967, 1635, 1855, 2146, 3015
AcuI	CTGAAG	6 cut(s)	147, 417, 714, 2076, 2553, 2606
AfiI	CCNNNNNNNGG	7 cut(s)	208, 439, 607, 1405, 1523, 2383, 3344
AgeI	ACCGGT	1 cut(s)	1808
AhdI	GACNNNNNGTC	2 cut(s)	457, 837
AhlI	ACTAGT	2 cut(s)	3293, 3389
AjiI	CACGTC	1 cut(s)	2638
AjnI	CCWGG	6 cut(s)	137, 290, 2025, 2429, 2440, 2852
Alw26I	GTCTC	6 cut(s)	8, 248, 616, 2061, 2106, 2961
AlwNI	CAGNNNCTG	2 cut(s)	2453, 3350
Ama87I	CYCGRG	1 cut(s)	11
Aor13HI	TCCGGA	1 cut(s)	1797
AoxI	GGCC	5 cut(s)	1256, 1751, 2136, 2593, 2967
ApeKI	GCWGC	9 cut(s)	392, 409, 912, 978, 1108, 1160, 1391, 1803, 2318
ApoI	RAATTY	5 cut(s)	967, 1635, 1855, 2146, 3015
AseI	ATTAAT	2 cut(s)	1548, 3198
AsiGI	ACCGGT	1 cut(s)	1808
Asp700I	GAANNNNTTC	3 cut(s)	218, 589, 852
AspS9I	GGNCC	9 cut(s)	76, 182, 1327, 1385, 1514, 2137, 2594, 2968, 3180
AsuC2I	CCSGG	1 cut(s)	279
AsuHPI	GGTGA	5 cut(s)	909, 1823, 1904, 1909, 2354
AsuII	TTCGAA	1 cut(s)	1089
AvaI	CYCGRG	1 cut(s)	11
AvaII	GGWCC	6 cut(s)	76, 182, 1327, 1385, 1514, 3180
AxyI	CCTNAGG	1 cut(s)	2200
BaeGI	GKGCMC	1 cut(s)	291
BalI	TGGCCA	1 cut(s)	1753
BarI	GAAGNNNNNNTAC	2 cut(s)	1644, 1676
BauI	CACGAG	1 cut(s)	2322
BbsI	GAAGAC	5 cut(s)	1098, 2541, 2612, 2833, 3390
BbvCI	CCTCAGC	1 cut(s)	2934
BbvI	GCAGC	9 cut(s)	379, 396, 924, 965, 1095, 1147, 1378, 1790, 2305
BceAI	ACGGC	2 cut(s)	1243, 1926
BciT130I	CCWGG	6 cut(s)	139, 292, 2027, 2431, 2442, 2854
BciVI	GTATCC	2 cut(s)	436, 1780
BclI	TGATCA	2 cut(s)	1431, 2680
BcnI	CCSGG	1 cut(s)	279
BcoDI	GTCTC	6 cut(s)	8, 248, 616, 2061, 2106, 2961
BcuI	ACTAGT	2 cut(s)	3293, 3389
BfaI	CTAG	8 cut(s)	27, 108, 842, 944, 1533, 1556, 3294, 3390
BfmI	CTRYAG	3 cut(s)	705, 1246, 2497
BfuAI	ACCTGC	1 cut(s)	928
BfuI	GTATCC	2 cut(s)	436, 1780
BglI	GCCNNNNNGGC	1 cut(s)	2719
BglII	AGATCT	3 cut(s)	796, 1657, 2600
BmcAI	AGTACT	3 cut(s)	362, 1915, 2503
Bme1390I	CCNGG	7 cut(s)	139, 279, 292, 2027, 2431, 2442, 2854
Bme18I	GGWCC	6 cut(s)	76, 182, 1327, 1385, 1514, 3180
BmeRI	GACNNNNNGTC	2 cut(s)	457, 837
BmeT110I	CYCGRG	1 cut(s)	11
BmgBI	CACGTC	1 cut(s)	2638
BmgT120I	GGNCC	9 cut(s)	76, 182, 1327, 1385, 1514, 2137, 2594, 2968, 3180
BmiI	GGNNCC	5 cut(s)	183, 1329, 2197, 2970, 3218
BmrFI	CCNGG	7 cut(s)	139, 279, 292, 2027, 2431, 2442, 2854
BmrI	ACTGGG	1 cut(s)	99
BmsI	GCATC	5 cut(s)	793, 1825, 2728, 2764, 2803
BmuI	ACTGGG	1 cut(s)	99
BpiI	GAAGAC	5 cut(s)	1098, 2541, 2612, 2833, 3390
BplI	GAGNNNNNCTC	4 cut(s)	2058, 2090, 2449, 2481
BpmI	CTGGAG	2 cut(s)	160, 2010
Bpu10I	CCTNAGC	2 cut(s)	2406, 2934
Bpu14I	TTCGAA	1 cut(s)	1089
BpuEI	CTTGAG	2 cut(s)	188, 1843
BpuMI	CCSGG	1 cut(s)	279
Bsa29I	ATCGAT	1 cut(s)	668
BsaI	GGTCTC	3 cut(s)	8, 248, 616
BsaJI	CCNNGG	7 cut(s)	290, 291, 2133, 2430, 2852, 2964, 2981
BsaWI	WCCGGW	2 cut(s)	1797, 1808
BsaXI	ACNNNNNCTCC	4 cut(s)	869, 899, 2752, 2782
Bsc4I	CCNNNNNNNGG	7 cut(s)	208, 439, 607, 1405, 1523, 2383, 3344
Bse118I	RCCGGY	2 cut(s)	1014, 1808
Bse1I	ACTGG	6 cut(s)	94, 1489, 1754, 1993, 2714, 3151
Bse21I	CCTNAGG	1 cut(s)	2200
Bse3DI	GCAATG	3 cut(s)	344, 532, 1929
BseAI	TCCGGA	1 cut(s)	1797
BseBI	CCWGG	6 cut(s)	139, 292, 2027, 2431, 2442, 2854
BseCI	ATCGAT	1 cut(s)	668
BseDI	CCNNGG	7 cut(s)	290, 291, 2133, 2430, 2852, 2964, 2981
BseLI	CCNNNNNNNGG	7 cut(s)	208, 439, 607, 1405, 1523, 2383, 3344
BseMI	GCAATG	3 cut(s)	344, 532, 1929
BseNI	ACTGG	6 cut(s)	94, 1489, 1754, 1993, 2714, 3151
BseRI	GAGGAG	4 cut(s)	604, 2454, 2760, 2850
BseSI	GKGCMC	1 cut(s)	291
BseXI	GCAGC	9 cut(s)	379, 396, 924, 965, 1095, 1147, 1378, 1790, 2305
BseYI	CCCAGC	2 cut(s)	601, 1104
BsgI	GTGCAG	4 cut(s)	906, 1094, 1789, 3279
Bsh1285I	CGRYCG	1 cut(s)	672
BshFI	GGCC	5 cut(s)	1258, 1753, 2138, 2595, 2969
BshTI	ACCGGT	1 cut(s)	1808
BshVI	ATCGAT	1 cut(s)	668
BsiEI	CGRYCG	1 cut(s)	672
BsiHKCI	CYCGRG	1 cut(s)	11
BsiSI	CCGG	4 cut(s)	279, 1015, 1798, 1809
BslFI	GGGAC	5 cut(s)	1147, 2447, 2763, 2835, 3022
BslI	CCNNNNNNNGG	7 cut(s)	208, 439, 607, 1405, 1523, 2383, 3344
BsmAI	GTCTC	6 cut(s)	8, 248, 616, 2061, 2106, 2961
BsmFI	GGGAC	5 cut(s)	1147, 2447, 2763, 2835, 3022
BsmI	GAATGC	5 cut(s)	571, 589, 591, 1846, 3333
BsnI	GGCC	5 cut(s)	1258, 1753, 2138, 2595, 2969
Bso31I	GGTCTC	3 cut(s)	8, 248, 616
BsoBI	CYCGRG	1 cut(s)	11
Bsp119I	TTCGAA	1 cut(s)	1089
Bsp1286I	GDGCHC	1 cut(s)	291
Bsp13I	TCCGGA	1 cut(s)	1797
Bsp1407I	TGTACA	2 cut(s)	1203, 1666
BspACI	CCGC	5 cut(s)	1933, 3028, 3178, 3316, 3454
BspANI	GGCC	5 cut(s)	1258, 1753, 2138, 2595, 2969
BspDI	ATCGAT	1 cut(s)	668
BspEI	TCCGGA	1 cut(s)	1797
BspHI	TCATGA	3 cut(s)	828, 1881, 2734
BspLI	GGNNCC	5 cut(s)	183, 1329, 2197, 2970, 3218
BspMAI	CTGCAG	1 cut(s)	1250
BspMI	ACCTGC	1 cut(s)	928
BspT104I	TTCGAA	1 cut(s)	1089
BspTNI	GGTCTC	3 cut(s)	8, 248, 616
BsrDI	GCAATG	3 cut(s)	344, 532, 1929
BsrFI	RCCGGY	2 cut(s)	1014, 1808
BsrGI	TGTACA	2 cut(s)	1203, 1666
BsrI	ACTGG	6 cut(s)	94, 1489, 1754, 1993, 2714, 3151
BssAI	RCCGGY	2 cut(s)	1014, 1808
BssECI	CCNNGG	7 cut(s)	290, 291, 2133, 2430, 2852, 2964, 2981
BssNAI	GTATAC	1 cut(s)	2414
BssSI	CACGAG	1 cut(s)	2322
BssT1I	CCWWGG	3 cut(s)	2133, 2964, 2981
Bst1107I	GTATAC	1 cut(s)	2414
Bst2BI	CACGAG	1 cut(s)	2322
Bst2UI	CCWGG	6 cut(s)	139, 292, 2027, 2431, 2442, 2854
Bst6I	CTCTTC	5 cut(s)	393, 1577, 2885, 2934, 3206
BstAUI	TGTACA	2 cut(s)	1203, 1666
BstBI	TTCGAA	1 cut(s)	1089
BstC8I	GCNNGC	4 cut(s)	351, 414, 2229, 3262
BstENI	CCTNNNNNAGG	1 cut(s)	2381
BstMAI	GTCTC	6 cut(s)	8, 248, 616, 2061, 2106, 2961
BstMCI	CGRYCG	1 cut(s)	672
BstMWI	GCNNNNNNNGC	5 cut(s)	422, 461, 2324, 2592, 2719
BstNI	CCWGG	6 cut(s)	139, 292, 2027, 2431, 2442, 2854
BstNSI	RCATGY	1 cut(s)	2213
BstSCI	CCNGG	7 cut(s)	137, 277, 290, 2025, 2429, 2440, 2852
BstSFI	CTRYAG	3 cut(s)	705, 1246, 2497
BstSLI	GKGCMC	1 cut(s)	291
BstV1I	GCAGC	9 cut(s)	379, 396, 924, 965, 1095, 1147, 1378, 1790, 2305
BstV2I	GAAGAC	5 cut(s)	1098, 2541, 2612, 2833, 3390
BstX2I	RGATCY	8 cut(s)	497, 796, 1051, 1657, 1794, 2600, 3170, 3347
BstXI	CCANNNNNNTGG	3 cut(s)	298, 1349, 1973
BstYI	RGATCY	8 cut(s)	497, 796, 1051, 1657, 1794, 2600, 3170, 3347
BstZ17I	GTATAC	1 cut(s)	2414
Bsu15I	ATCGAT	1 cut(s)	668
Bsu36I	CCTNAGG	1 cut(s)	2200
BsuI	GTATCC	2 cut(s)	436, 1780
BsuRI	GGCC	5 cut(s)	1258, 1753, 2138, 2595, 2969
BsuTUI	ATCGAT	1 cut(s)	668
BtrI	CACGTC	1 cut(s)	2638
BtsI	GCAGTG	1 cut(s)	2454
BtsIMutI	CAGTG	7 cut(s)	291, 1120, 1857, 1863, 2266, 2301, 2454
BveI	ACCTGC	1 cut(s)	928
Cac8I	GCNNGC	4 cut(s)	351, 414, 2229, 3262
CaiI	CAGNNNCTG	2 cut(s)	2453, 3350
CciI	TCATGA	3 cut(s)	828, 1881, 2734
Cfr10I	RCCGGY	2 cut(s)	1014, 1808
Cfr13I	GGNCC	9 cut(s)	76, 182, 1327, 1385, 1514, 2137, 2594, 2968, 3180
ClaI	ATCGAT	1 cut(s)	668
CseI	GACGC	1 cut(s)	461
CspAI	ACCGGT	1 cut(s)	1808
CspCI	CAANNNNNGTGG	2 cut(s)	2320, 2355
DraI	TTTAAA	1 cut(s)	1722
DrdI	GACNNNNNNGTC	1 cut(s)	2953
DriI	GACNNNNNGTC	2 cut(s)	457, 837
DseDI	GACNNNNNNGTC	1 cut(s)	2953
EaeI	YGGCCR	1 cut(s)	1751
Eam1104I	CTCTTC	5 cut(s)	393, 1577, 2885, 2934, 3206
Eam1105I	GACNNNNNGTC	2 cut(s)	457, 837
EarI	CTCTTC	5 cut(s)	393, 1577, 2885, 2934, 3206
Eco130I	CCWWGG	3 cut(s)	2133, 2964, 2981
Eco31I	GGTCTC	3 cut(s)	8, 248, 616
Eco32I	GATATC	2 cut(s)	1600, 2628
Eco47I	GGWCC	6 cut(s)	76, 182, 1327, 1385, 1514, 3180
Eco57I	CTGAAG	6 cut(s)	147, 417, 714, 2076, 2553, 2606
Eco81I	CCTNAGG	1 cut(s)	2200
Eco88I	CYCGRG	1 cut(s)	11
EcoNI	CCTNNNNNAGG	1 cut(s)	2381
EcoO109I	RGGNCCY	1 cut(s)	2968
EcoRI	GAATTC	2 cut(s)	1855, 2146
EcoRII	CCWGG	6 cut(s)	137, 290, 2025, 2429, 2440, 2852
EcoRV	GATATC	2 cut(s)	1600, 2628
EcoT14I	CCWWGG	3 cut(s)	2133, 2964, 2981
EcoT22I	ATGCAT	4 cut(s)	573, 591, 1466, 1848
ErhI	CCWWGG	3 cut(s)	2133, 2964, 2981
FalI	AAGNNNNNCTT	2 cut(s)	2913, 2945
FaqI	GGGAC	5 cut(s)	1147, 2447, 2763, 2835, 3022
FbaI	TGATCA	2 cut(s)	1431, 2680
FblI	GTMKAC	3 cut(s)	1154, 1242, 2413
FspBI	CTAG	8 cut(s)	27, 108, 842, 944, 1533, 1556, 3294, 3390
GsaI	CCCAGC	2 cut(s)	605, 1108
GsuI	CTGGAG	2 cut(s)	160, 2010
HaeIII	GGCC	5 cut(s)	1258, 1753, 2138, 2595, 2969
HapII	CCGG	4 cut(s)	279, 1015, 1798, 1809
HgaI	GACGC	1 cut(s)	461
HincII	GTYRAC	4 cut(s)	745, 1530, 2023, 3438
HindII	GTYRAC	4 cut(s)	745, 1530, 2023, 3438
HindIII	AAGCTT	1 cut(s)	984
HpaII	CCGG	4 cut(s)	279, 1015, 1798, 1809
HphI	GGTGA	5 cut(s)	909, 1823, 1904, 1909, 2354
Hpy99I	CGWCG	2 cut(s)	46, 3360
HpyCH4IV	ACGT	3 cut(s)	884, 1756, 2637
HpyF10VI	GCNNNNNNNGC	5 cut(s)	422, 461, 2324, 2592, 2719
HpySE526I	ACGT	3 cut(s)	884, 1756, 2637
Kpn2I	TCCGGA	1 cut(s)	1797
Ksp22I	TGATCA	2 cut(s)	1431, 2680
LmnI	GCTCC	4 cut(s)	1800, 2201, 2444, 2773
Lsp1109I	GCAGC	9 cut(s)	379, 396, 924, 965, 1095, 1147, 1378, 1790, 2305
LweI	GCATC	5 cut(s)	793, 1825, 2728, 2764, 2803
MaeI	CTAG	8 cut(s)	27, 108, 842, 944, 1533, 1556, 3294, 3390
MaeII	ACGT	3 cut(s)	884, 1756, 2637
MaeIII	GTNAC	6 cut(s)	864, 1001, 2059, 2449, 2878, 3118
MfeI	CAATTG	2 cut(s)	1028, 1267
MflI	RGATCY	8 cut(s)	497, 796, 1051, 1657, 1794, 2600, 3170, 3347
MhlI	GDGCHC	1 cut(s)	291
MlsI	TGGCCA	1 cut(s)	1753
MluNI	TGGCCA	1 cut(s)	1753
MlyI	GAGTC	6 cut(s)	1248, 2248, 2455, 2851, 2941, 2963
MmeI	TCCRAC	3 cut(s)	855, 2894, 3362
Mox20I	TGGCCA	1 cut(s)	1753
Mph1103I	ATGCAT	4 cut(s)	573, 591, 1466, 1848
MroI	TCCGGA	1 cut(s)	1797
MroXI	GAANNNNTTC	3 cut(s)	218, 589, 852
MscI	TGGCCA	1 cut(s)	1753
MslI	CAYNNNNRTG	1 cut(s)	1971
Msp20I	TGGCCA	1 cut(s)	1753
MspA1I	CMGCKG	2 cut(s)	1108, 1391
MspI	CCGG	4 cut(s)	279, 1015, 1798, 1809
MspR9I	CCNGG	7 cut(s)	139, 279, 292, 2027, 2431, 2442, 2854
MunI	CAATTG	2 cut(s)	1028, 1267
Mva1269I	GAATGC	5 cut(s)	571, 589, 591, 1846, 3333
MvaI	CCWGG	6 cut(s)	139, 292, 2027, 2431, 2442, 2854
MwoI	GCNNNNNNNGC	5 cut(s)	422, 461, 2324, 2592, 2719
NciI	CCSGG	1 cut(s)	279
NlaIV	GGNNCC	5 cut(s)	183, 1329, 2197, 2970, 3218
NmuCI	GTSAC	1 cut(s)	2449
NsiI	ATGCAT	4 cut(s)	573, 591, 1466, 1848
NspI	RCATGY	1 cut(s)	2213
NspV	TTCGAA	1 cut(s)	1089
PagI	TCATGA	3 cut(s)	828, 1881, 2734
PaqCI	CACCTGC	1 cut(s)	928
PasI	CCCWGGG	1 cut(s)	291
PctI	GAATGC	5 cut(s)	571, 589, 591, 1846, 3333
PdmI	GAANNNNTTC	3 cut(s)	218, 589, 852
PflMI	CCANNNNNTGG	1 cut(s)	1523
PinAI	ACCGGT	1 cut(s)	1808
Ple19I	CGATCG	1 cut(s)	672
PleI	GAGTC	6 cut(s)	1247, 2247, 2455, 2851, 2941, 2962
PpsI	GAGTC	6 cut(s)	1247, 2247, 2455, 2851, 2941, 2962
PshBI	ATTAAT	2 cut(s)	1548, 3198
PsiI	TTATAA	1 cut(s)	543
Psp6I	CCWGG	6 cut(s)	137, 290, 2025, 2429, 2440, 2852
PspFI	CCCAGC	2 cut(s)	601, 1104
PspGI	CCWGG	6 cut(s)	137, 290, 2025, 2429, 2440, 2852
PspN4I	GGNNCC	5 cut(s)	183, 1329, 2197, 2970, 3218
PspPI	GGNCC	9 cut(s)	76, 182, 1327, 1385, 1514, 2137, 2594, 2968, 3180
PstI	CTGCAG	1 cut(s)	1250
PstNI	CAGNNNCTG	2 cut(s)	2453, 3350
PsuI	RGATCY	8 cut(s)	497, 796, 1051, 1657, 1794, 2600, 3170, 3347
PvuI	CGATCG	1 cut(s)	672
PvuII	CAGCTG	2 cut(s)	1108, 1391
RseI	CAYNNNNRTG	1 cut(s)	1971
Sau96I	GGNCC	9 cut(s)	76, 182, 1327, 1385, 1514, 2137, 2594, 2968, 3180
ScaI	AGTACT	3 cut(s)	362, 1915, 2503
SchI	GAGTC	6 cut(s)	1248, 2248, 2455, 2851, 2941, 2963
ScrFI	CCNGG	7 cut(s)	139, 279, 292, 2027, 2431, 2442, 2854
SduI	GDGCHC	1 cut(s)	291
SfaNI	GCATC	5 cut(s)	793, 1825, 2728, 2764, 2803
SfcI	CTRYAG	3 cut(s)	705, 1246, 2497
SfuI	TTCGAA	1 cut(s)	1089
SgrAI	CRCCGGYG	1 cut(s)	1808
SinI	GGWCC	6 cut(s)	76, 182, 1327, 1385, 1514, 3180
SmiMI	CAYNNNNRTG	1 cut(s)	1971
SmlI	CTYRAG	2 cut(s)	167, 1822
SmoI	CTYRAG	2 cut(s)	167, 1822
SpeI	ACTAGT	2 cut(s)	3293, 3389
SsiI	CCGC	5 cut(s)	1933, 3028, 3178, 3316, 3454
SspI	AATATT	1 cut(s)	1234
SspMI	CTAG	8 cut(s)	27, 108, 842, 944, 1533, 1556, 3294, 3390
StyD4I	CCNGG	7 cut(s)	137, 277, 290, 2025, 2429, 2440, 2852
StyI	CCWWGG	3 cut(s)	2133, 2964, 2981
TaiI	ACGT	3 cut(s)	887, 1759, 2640
TaqI	TCGA	5 cut(s)	668, 672, 1089, 1903, 2974
TaqII	GACCGA	1 cut(s)	93
TatI	WGTACW	5 cut(s)	360, 1203, 1666, 1913, 2501
TauI	GCSGC	1 cut(s)	3319
TscAI	CASTG	7 cut(s)	291, 1120, 1857, 1870, 2266, 2308, 2454
TseFI	GTSAC	1 cut(s)	2449
TseI	GCWGC	9 cut(s)	392, 409, 912, 978, 1108, 1160, 1391, 1803, 2318
Tsp45I	GTSAC	1 cut(s)	2449
TspGWI	ACGGA	4 cut(s)	30, 73, 700, 807
TspRI	CASTG	7 cut(s)	291, 1120, 1857, 1870, 2266, 2308, 2454
Van91I	CCANNNNNTGG	1 cut(s)	1523
VpaK11BI	GGWCC	6 cut(s)	76, 182, 1327, 1385, 1514, 3180
VspI	ATTAAT	2 cut(s)	1548, 3198
XagI	CCTNNNNNAGG	1 cut(s)	2381
XapI	RAATTY	5 cut(s)	967, 1635, 1855, 2146, 3015
XbaI	TCTAGA	2 cut(s)	841, 943
XceI	RCATGY	1 cut(s)	2213
XmiI	GTMKAC	3 cut(s)	1154, 1242, 2413
XmnI	GAANNNNTTC	3 cut(s)	218, 589, 852
XspI	CTAG	8 cut(s)	27, 108, 842, 944, 1533, 1556, 3294, 3390
ZrmI	AGTACT	3 cut(s)	362, 1915, 2503
Zsp2I	ATGCAT	4 cut(s)	573, 591, 1466, 1848

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.