Rmu_sc0000528.1_g000026

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000528.1
Physical Location & Seq
Forward (+)
101738 .. 102247
510 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000528.1_g000026.1.cds

Sequence Viewer

Length: 369 bp
atgtttggaacagcaataaggtttattgggagaaaaccgaaaccaaagatgaaaccaatagagctcaaaaccccacctgagcagacacagaccatcactaggaccatctttgacatcgtgaaggagcacggtcctctcaccatttctgaaacctgggatcacgttaaggaagttggtttaagaggactgacgagcaagaggcatatgaagatagtgttgaggtggatgaaggagaggcagaagcttagacaaatatgcaaccatgtagggcctaataagcagtttctgtatacgacttggttcacaaaacccaacaccaagcagcagccaaaaccagtaaacggttctccacaacccaagttcccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

122

Amino Acids

14.3

Weight (kDa)

10.62

Isoelectric Point (pI)

43.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012500)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 290
AclWI GGATC 1 cut(s) 165
AfiI CCNNNNNNNGG 2 cut(s) 99, 341
AjnI CCWGG 1 cut(s) 152
AluBI AGCT 2 cut(s) 64, 244
AluI AGCT 2 cut(s) 64, 244
Alw21I GWGCWC 2 cut(s) 66, 129
AlwI GGATC 1 cut(s) 165
AlwNI CAGNNNCTG 1 cut(s) 286
AoxI GGCC 1 cut(s) 269
ApeKI GCWGC 2 cut(s) 322, 325
AspS9I GGNCC 3 cut(s) 102, 131, 269
AsuHPI GGTGA 1 cut(s) 130
AvaII GGWCC 2 cut(s) 102, 131
BanII GRGCYC 1 cut(s) 66
Bbv12I GWGCWC 2 cut(s) 66, 129
BbvI GCAGC 2 cut(s) 334, 337
BccI CCATC 2 cut(s) 101, 113
BciT130I CCWGG 1 cut(s) 154
BfaI CTAG 1 cut(s) 99
BisI GCNGC 2 cut(s) 323, 326
BlsI GCNGC 2 cut(s) 324, 327
Bme1390I CCNGG 1 cut(s) 154
Bme18I GGWCC 2 cut(s) 102, 131
BmgT120I GGNCC 3 cut(s) 102, 131, 269
BmrFI CCNGG 1 cut(s) 154
Bpu10I CCTNAGC 1 cut(s) 78
BsaJI CCNNGG 1 cut(s) 153
Bsc4I CCNNNNNNNGG 2 cut(s) 99, 341
Bse1I ACTGG 1 cut(s) 335
BseBI CCWGG 1 cut(s) 154
BseDI CCNNGG 1 cut(s) 153
BseGI GGATG 1 cut(s) 231
BseLI CCNNNNNNNGG 2 cut(s) 99, 341
BseMII CTCAG 1 cut(s) 69
BseNI ACTGG 1 cut(s) 335
BseXI GCAGC 2 cut(s) 334, 337
BshFI GGCC 1 cut(s) 271
BsiHKAI GWGCWC 2 cut(s) 66, 129
BslI CCNNNNNNNGG 2 cut(s) 99, 341
BsnI GGCC 1 cut(s) 271
Bsp1286I GDGCHC 2 cut(s) 66, 129
Bsp143I GATC 1 cut(s) 157
BspANI GGCC 1 cut(s) 271
BspCNI CTCAG 1 cut(s) 70
BspPI GGATC 1 cut(s) 165
BsrI ACTGG 1 cut(s) 335
BssECI CCNNGG 1 cut(s) 153
BssMI GATC 1 cut(s) 157
BssNAI GTATAC 1 cut(s) 291
Bst1107I GTATAC 1 cut(s) 291
Bst2UI CCWGG 1 cut(s) 154
Bst4CI ACNGT 2 cut(s) 131, 344
BstDEI CTNAG 2 cut(s) 78, 245
BstF5I GGATG 1 cut(s) 231
BstKTI GATC 1 cut(s) 160
BstMBI GATC 1 cut(s) 157
BstMWI GCNNNNNNNGC 1 cut(s) 277
BstNI CCWGG 1 cut(s) 154
BstSCI CCNGG 1 cut(s) 152
BstV1I GCAGC 2 cut(s) 334, 337
BstZ17I GTATAC 1 cut(s) 291
BsuRI GGCC 1 cut(s) 271
BtsCI GGATG 1 cut(s) 231
CaiI CAGNNNCTG 1 cut(s) 286
Cfr13I GGNCC 3 cut(s) 102, 131, 269
CviAII CATG 1 cut(s) 263
CviJI RGCY 4 cut(s) 64, 244, 271, 328
CviKI_1 RGCY 4 cut(s) 64, 244, 271, 328
DdeI CTNAG 2 cut(s) 78, 245
DpnI GATC 1 cut(s) 159
DpnII GATC 1 cut(s) 157
Ecl136II GAGCTC 1 cut(s) 64
Eco24I GRGCYC 1 cut(s) 66
Eco47I GGWCC 2 cut(s) 102, 131
Eco53kI GAGCTC 1 cut(s) 64
EcoICRI GAGCTC 1 cut(s) 64
EcoO109I RGGNCCY 1 cut(s) 269
EcoRII CCWGG 1 cut(s) 152
EcoT38I GRGCYC 1 cut(s) 66
FaeI CATG 1 cut(s) 266
FaiI YATR 5 cut(s) 204, 206, 256, 264, 291
FatI CATG 1 cut(s) 262
FauNDI CATATG 1 cut(s) 204
FblI GTMKAC 1 cut(s) 290
Fnu4HI GCNGC 2 cut(s) 323, 326
FokI GGATG 1 cut(s) 238
FriOI GRGCYC 1 cut(s) 66
Fsp4HI GCNGC 2 cut(s) 323, 326
FspBI CTAG 1 cut(s) 99
GluI GCNGC 2 cut(s) 323, 326
HaeIII GGCC 1 cut(s) 271
Hin1II CATG 1 cut(s) 266
HindIII AAGCTT 1 cut(s) 242
HphI GGTGA 1 cut(s) 130
Hpy166II GTNNAC 3 cut(s) 291, 303, 340
Hpy188I TCNGA 1 cut(s) 148
Hpy188III TCNNGA 1 cut(s) 118
Hpy8I GTNNAC 3 cut(s) 291, 303, 340
HpyAV CCTTC 2 cut(s) 115, 223
HpyCH4III ACNGT 2 cut(s) 131, 344
HpyCH4IV ACGT 1 cut(s) 162
HpyCH4V TGCA 1 cut(s) 258
HpyF10VI GCNNNNNNNGC 1 cut(s) 277
HpyF3I CTNAG 2 cut(s) 78, 245
HpySE526I ACGT 1 cut(s) 162
Hsp92II CATG 1 cut(s) 266
Kzo9I GATC 1 cut(s) 157
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 4 cut(s) 90, 139, 166, 348
Lsp1109I GCAGC 2 cut(s) 334, 337
MaeI CTAG 1 cut(s) 99
MaeII ACGT 1 cut(s) 162
MalI GATC 1 cut(s) 159
MboI GATC 1 cut(s) 157
MboII GAAGA 1 cut(s) 220
MhlI GDGCHC 2 cut(s) 66, 129
MnlI CCTC 5 cut(s) 144, 176, 192, 213, 228
MseI TTAA 2 cut(s) 165, 179
MspR9I CCNGG 1 cut(s) 154
MvaI CCWGG 1 cut(s) 154
MwoI GCNNNNNNNGC 1 cut(s) 277
NdeI CATATG 1 cut(s) 204
NdeII GATC 1 cut(s) 157
NlaIII CATG 1 cut(s) 266
PkrI GCNGC 2 cut(s) 324, 327
Psp124BI GAGCTC 1 cut(s) 66
Psp6I CCWGG 1 cut(s) 152
PspGI CCWGG 1 cut(s) 152
PspPI GGNCC 3 cut(s) 102, 131, 269
PstNI CAGNNNCTG 1 cut(s) 286
SacI GAGCTC 1 cut(s) 66
SaqAI TTAA 2 cut(s) 165, 179
SatI GCNGC 2 cut(s) 323, 326
Sau3AI GATC 1 cut(s) 157
Sau96I GGNCC 3 cut(s) 102, 131, 269
ScrFI CCNGG 1 cut(s) 154
SduI GDGCHC 2 cut(s) 66, 129
SetI ASST 7 cut(s) 23, 66, 79, 155, 165, 224, 246
SinI GGWCC 2 cut(s) 102, 131
SspMI CTAG 1 cut(s) 99
SstI GAGCTC 1 cut(s) 66
StyD4I CCNGG 1 cut(s) 152
TaaI ACNGT 2 cut(s) 131, 344
TaiI ACGT 1 cut(s) 165
Tru1I TTAA 2 cut(s) 165, 179
Tru9I TTAA 2 cut(s) 165, 179
TseI GCWGC 2 cut(s) 322, 325
TspDTI ATGAA 3 cut(s) 65, 221, 242
VpaK11BI GGWCC 2 cut(s) 102, 131
XmiI GTMKAC 1 cut(s) 290
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.