Rorug02G0088300

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
7068888 .. 7069230
343 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0088300.1

Sequence Viewer

Length: 240 bp
ATGAGGACTTTGCGAGAAGCTTATCAAGCTAGCCCTGATTTGGTGTTGAGGTTTAAGCTGAATGCTCCTTTGAACAAGTATATTAAGGAAACTTTCTACACCGATGACCCTATAGTTGGATGCACAAACTACCCTTTTCTTAACAGAGAAAGTGTGAAAGAGGATGAGCGTCCTCCCTTTGATTTTGATGCTGTTGAAATTGTTCTTGTTCGTTTGGATGAACAAAACCTTCACATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

9.33

Weight (kDa)

4.84

Isoelectric Point (pI)

51.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012500)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 40, 116
AgsI TTSAA 2 cut(s) 73, 197
AluBI AGCT 3 cut(s) 20, 29, 58
AluI AGCT 3 cut(s) 20, 29, 58
Asp700I GAANNNNTTC 1 cut(s) 201
AsuNHI GCTAGC 1 cut(s) 29
BfaI CTAG 1 cut(s) 30
BfmI CTRYAG 1 cut(s) 111
BmsI GCATC 2 cut(s) 110, 178
BmtI GCTAGC 1 cut(s) 33
Bsc4I CCNNNNNNNGG 2 cut(s) 40, 116
BseGI GGATG 3 cut(s) 125, 169, 223
BseLI CCNNNNNNNGG 2 cut(s) 40, 116
BslI CCNNNNNNNGG 2 cut(s) 40, 116
BsmI GAATGC 1 cut(s) 67
BspOI GCTAGC 1 cut(s) 33
BstC8I GCNNGC 1 cut(s) 31
BstF5I GGATG 3 cut(s) 125, 169, 223
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstSFI CTRYAG 1 cut(s) 111
BtsCI GGATG 3 cut(s) 125, 169, 223
Cac8I GCNNGC 1 cut(s) 31
CseI GACGC 1 cut(s) 158
CviJI RGCY 4 cut(s) 20, 29, 33, 58
CviKI_1 RGCY 4 cut(s) 20, 29, 33, 58
FaiI YATR 4 cut(s) 81, 113, 236, 238
FokI GGATG 3 cut(s) 132, 176, 230
FspBI CTAG 1 cut(s) 30
HgaI GACGC 1 cut(s) 158
HindIII AAGCTT 1 cut(s) 18
HpyAV CCTTC 1 cut(s) 239
HpyCH4V TGCA 1 cut(s) 123
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
LmnI GCTCC 1 cut(s) 70
LpnPI CCDG 1 cut(s) 48
LweI GCATC 2 cut(s) 110, 178
MaeI CTAG 1 cut(s) 30
MluCI AATT 1 cut(s) 198
MmeI TCCRAC 1 cut(s) 97
MnlI CCTC 3 cut(s) 42, 154, 183
MroXI GAANNNNTTC 1 cut(s) 201
MseI TTAA 3 cut(s) 54, 84, 141
Mva1269I GAATGC 1 cut(s) 67
MwoI GCNNNNNNNGC 1 cut(s) 26
NheI GCTAGC 1 cut(s) 29
PctI GAATGC 1 cut(s) 67
PdmI GAANNNNTTC 1 cut(s) 201
SaqAI TTAA 3 cut(s) 54, 84, 141
SetI ASST 5 cut(s) 22, 31, 53, 60, 231
SfaNI GCATC 2 cut(s) 110, 178
SfcI CTRYAG 1 cut(s) 111
SgeI CNNG 6 cut(s) 26, 38, 42, 47, 88, 218
Sse9I AATT 1 cut(s) 198
SspMI CTAG 1 cut(s) 30
TasI AATT 1 cut(s) 198
Tru1I TTAA 3 cut(s) 54, 84, 141
Tru9I TTAA 3 cut(s) 54, 84, 141
TspDTI ATGAA 1 cut(s) 234
XmnI GAANNNNTTC 1 cut(s) 201
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.