Rmu_sc0000570.1_g000012

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000570.1
Physical Location & Seq
Reverse (-)
78690 .. 79551
862 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000570.1_g000012.1.cds

Sequence Viewer

Length: 396 bp
atgggttttggacctttgtgcttgtctcatctaaaagaggcacaagaatttgaattggtacaatttgaattggatcttcgcacagcacgagcagaactgggtgaaggcaggccaataaaattaattgtcagtctcacagctatttgtttgatcagtatcttgggtgccatagtgtttggtttgtacaggttgcgagctagccaaagaggaaaaatcagagtaaaaacagggaattgctacaaacaatttcagtctcgcaaacaaactcgggcaaggaggatttggccctgttataaggataagctacttgaagggaaggaaatagcagtgaaaagactatctagtagcttggctgaggccaaggcaaagaagaggtcaagaatcagacgttgttga

Protein Analysis

131

Amino Acids

14.98

Weight (kDa)

10.44

Isoelectric Point (pI)

39.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020387)

Species Orthologous Gene IDs
malus_domestica MD04G1234000.v1.1 MD08G1086100.v1.1
rosa_multiflora Rmu_sc0000570.1_g000012
rosa_samantha Rh2BG574200 Rh4AG169400
rosa_wichuraiana Rw1G008680

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 294
AccB1I GGYRCC 1 cut(s) 164
AclWI GGATC 1 cut(s) 81
AcsI RAATTY 1 cut(s) 47
AfaI GTAC 2 cut(s) 60, 185
AgsI TTSAA 3 cut(s) 53, 68, 311
AluBI AGCT 4 cut(s) 140, 197, 304, 348
AluI AGCT 4 cut(s) 140, 197, 304, 348
Alw26I GTCTC 3 cut(s) 30, 137, 258
AlwI GGATC 1 cut(s) 81
Ama87I CYCGRG 1 cut(s) 267
AoxI GGCC 3 cut(s) 110, 284, 357
ApoI RAATTY 1 cut(s) 47
ArsI GACNNNNNNTTYG 2 cut(s) 359, 391
AseI ATTAAT 1 cut(s) 122
AspS9I GGNCC 2 cut(s) 11, 285
AsuHPI GGTGA 1 cut(s) 113
AsuNHI GCTAGC 1 cut(s) 197
AvaI CYCGRG 1 cut(s) 267
AvaII GGWCC 1 cut(s) 11
BanI GGYRCC 1 cut(s) 164
BauI CACGAG 1 cut(s) 87
BbvCI CCTCAGC 1 cut(s) 354
BclI TGATCA 1 cut(s) 150
BcoDI GTCTC 3 cut(s) 30, 137, 258
BfaI CTAG 2 cut(s) 198, 342
Bme18I GGWCC 1 cut(s) 11
BmeT110I CYCGRG 1 cut(s) 267
BmgT120I GGNCC 2 cut(s) 11, 285
BmiI GGNNCC 1 cut(s) 166
BmrI ACTGGG 1 cut(s) 107
BmtI GCTAGC 1 cut(s) 201
BmuI ACTGGG 1 cut(s) 107
Bpu10I CCTNAGC 1 cut(s) 354
BsaBI GATNNNNATC 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 360
Bse1I ACTGG 1 cut(s) 102
Bse8I GATNNNNATC 1 cut(s) 155
BseDI CCNNGG 1 cut(s) 360
BseJI GATNNNNATC 1 cut(s) 155
BseMII CTCAG 1 cut(s) 345
BseNI ACTGG 1 cut(s) 102
BshFI GGCC 3 cut(s) 112, 286, 359
BshNI GGYRCC 1 cut(s) 164
BsiHKCI CYCGRG 1 cut(s) 267
BsmAI GTCTC 3 cut(s) 30, 137, 258
BsnI GGCC 3 cut(s) 112, 286, 359
BsoBI CYCGRG 1 cut(s) 267
Bsp1407I TGTACA 1 cut(s) 183
Bsp143I GATC 2 cut(s) 73, 150
BspANI GGCC 3 cut(s) 112, 286, 359
BspCNI CTCAG 1 cut(s) 346
BspLI GGNNCC 1 cut(s) 166
BspOI GCTAGC 1 cut(s) 201
BspPI GGATC 1 cut(s) 81
BspT107I GGYRCC 1 cut(s) 164
BsrGI TGTACA 1 cut(s) 183
BsrI ACTGG 1 cut(s) 102
BssECI CCNNGG 1 cut(s) 360
BssMI GATC 2 cut(s) 73, 150
BssSI CACGAG 1 cut(s) 87
BssT1I CCWWGG 1 cut(s) 360
Bst2BI CACGAG 1 cut(s) 87
Bst6I CTCTTC 1 cut(s) 365
BstAUI TGTACA 1 cut(s) 183
BstC8I GCNNGC 3 cut(s) 110, 195, 199
BstDEI CTNAG 1 cut(s) 354
BstKTI GATC 2 cut(s) 76, 153
BstMAI GTCTC 3 cut(s) 30, 137, 258
BstMBI GATC 2 cut(s) 73, 150
BstX2I RGATCY 1 cut(s) 73
BstYI RGATCY 1 cut(s) 73
BsuRI GGCC 3 cut(s) 112, 286, 359
BtsI GCAGTG 1 cut(s) 333
BtsIMutI CAGTG 1 cut(s) 333
Cac8I GCNNGC 3 cut(s) 110, 195, 199
Cfr13I GGNCC 2 cut(s) 11, 285
Csp6I GTAC 2 cut(s) 59, 184
CviJI RGCY 9 cut(s) 112, 140, 197, 201, 286, 304, 348, 353, 359
CviKI_1 RGCY 9 cut(s) 112, 140, 197, 201, 286, 304, 348, 353, 359
CviQI GTAC 2 cut(s) 59, 184
DdeI CTNAG 1 cut(s) 354
DpnI GATC 2 cut(s) 75, 152
DpnII GATC 2 cut(s) 73, 150
Eam1104I CTCTTC 1 cut(s) 365
EarI CTCTTC 1 cut(s) 365
Eco130I CCWWGG 1 cut(s) 360
Eco47I GGWCC 1 cut(s) 11
Eco88I CYCGRG 1 cut(s) 267
EcoT14I CCWWGG 1 cut(s) 360
ErhI CCWWGG 1 cut(s) 360
FaiI YATR 2 cut(s) 170, 294
FbaI TGATCA 1 cut(s) 150
FspBI CTAG 2 cut(s) 198, 342
HaeIII GGCC 3 cut(s) 112, 286, 359
HinfI GANTC 1 cut(s) 381
HphI GGTGA 1 cut(s) 113
Hpy188I TCNGA 2 cut(s) 218, 386
Hpy188III TCNNGA 1 cut(s) 378
HpyAV CCTTC 3 cut(s) 98, 305, 310
HpyCH4IV ACGT 1 cut(s) 388
HpyF3I CTNAG 1 cut(s) 354
HpySE526I ACGT 1 cut(s) 388
Ksp22I TGATCA 1 cut(s) 150
Kzo9I GATC 2 cut(s) 73, 150
LpnPI CCDG 5 cut(s) 83, 94, 172, 213, 301
MaeI CTAG 2 cut(s) 198, 342
MaeII ACGT 1 cut(s) 388
MalI GATC 2 cut(s) 75, 152
MboI GATC 2 cut(s) 73, 150
MboII GAAGA 2 cut(s) 68, 382
MflI RGATCY 1 cut(s) 73
MluCI AATT 8 cut(s) 47, 53, 62, 68, 119, 123, 232, 245
MnlI CCTC 5 cut(s) 31, 200, 270, 349, 366
MseI TTAA 1 cut(s) 122
NdeII GATC 2 cut(s) 73, 150
NheI GCTAGC 1 cut(s) 197
NlaIV GGNNCC 1 cut(s) 166
PcsI WCGNNNNNNNCGW 1 cut(s) 85
PfeI GAWTC 1 cut(s) 381
PshBI ATTAAT 1 cut(s) 122
PsiI TTATAA 1 cut(s) 294
PspN4I GGNNCC 1 cut(s) 166
PspPI GGNCC 2 cut(s) 11, 285
PsuI RGATCY 1 cut(s) 73
RsaI GTAC 2 cut(s) 60, 185
RsaNI GTAC 2 cut(s) 59, 184
SaqAI TTAA 1 cut(s) 122
Sau3AI GATC 2 cut(s) 73, 150
Sau96I GGNCC 2 cut(s) 11, 285
SetI ASST 8 cut(s) 16, 142, 191, 199, 306, 350, 377, 391
SinI GGWCC 1 cut(s) 11
Sse9I AATT 8 cut(s) 47, 53, 62, 68, 119, 123, 232, 245
SspMI CTAG 2 cut(s) 198, 342
StyI CCWWGG 1 cut(s) 360
TaiI ACGT 1 cut(s) 391
TasI AATT 8 cut(s) 47, 53, 62, 68, 119, 123, 232, 245
TatI WGTACW 1 cut(s) 183
TfiI GAWTC 1 cut(s) 381
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
TscAI CASTG 1 cut(s) 333
TspRI CASTG 1 cut(s) 333
VpaK11BI GGWCC 1 cut(s) 11
VspI ATTAAT 1 cut(s) 122
XapI RAATTY 1 cut(s) 47
XspI CTAG 2 cut(s) 198, 342
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.