Rw1G008680

Translational activator

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Forward (+)
18948508 .. 18950526
2019 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G008680.1

Sequence Viewer

Length: 306 bp
ATGAATGCTATACGTGAAAGTTGGTGTCTGCTAATATTGGTTCCAGGTAAAGGAAAGCCAATGAAGTTAATTTCCAGCCTTATAGCTATTTTTCCTATCAGTATCTTGTTTGCCATAGTGTTCATTTGGTACAGCTTGCAAGCTAACCGAAAGGAATCAGGACAGATCATATCAACAAAACAGCATTTTGAATCGACTGCTCCAAGTGCATCAATGCGAGCTTTATTCTGCGGACACTATCCATTCTTAGTTGGAACTGCAAAAAGAGATGCAGTTTGGAGGGGAAAGACAAGCTTGGTGAACTGA

Protein Analysis

101

Amino Acids

11.27

Weight (kDa)

10.11

Isoelectric Point (pI)

36.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020387)

Species Orthologous Gene IDs
malus_domestica MD04G1234000.v1.1 MD08G1086100.v1.1
rosa_multiflora Rmu_sc0000570.1_g000012
rosa_samantha Rh2BG574200 Rh4AG169400
rosa_wichuraiana Rw1G008680

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 231
AfaI GTAC 1 cut(s) 131
AfiI CCNNNNNNNGG 1 cut(s) 50
AgsI TTSAA 1 cut(s) 191
AjnI CCWGG 1 cut(s) 43
AluBI AGCT 5 cut(s) 86, 135, 143, 221, 294
AluI AGCT 5 cut(s) 86, 135, 143, 221, 294
BciT130I CCWGG 1 cut(s) 45
Bme1390I CCNGG 1 cut(s) 45
BmiI GGNNCC 1 cut(s) 42
BmrFI CCNGG 1 cut(s) 45
BmsI GCATC 2 cut(s) 218, 259
BsaAI YACGTR 1 cut(s) 14
Bsc4I CCNNNNNNNGG 1 cut(s) 50
BseBI CCWGG 1 cut(s) 45
BseLI CCNNNNNNNGG 1 cut(s) 50
BslI CCNNNNNNNGG 1 cut(s) 50
BsmI GAATGC 1 cut(s) 10
Bsp143I GATC 1 cut(s) 165
BspACI CCGC 1 cut(s) 231
BspLI GGNNCC 1 cut(s) 42
BssMI GATC 1 cut(s) 165
Bst2UI CCWGG 1 cut(s) 45
BstBAI YACGTR 1 cut(s) 14
BstC8I GCNNGC 3 cut(s) 137, 141, 219
BstDEI CTNAG 1 cut(s) 247
BstKTI GATC 1 cut(s) 168
BstMBI GATC 1 cut(s) 165
BstMWI GCNNNNNNNGC 1 cut(s) 206
BstNI CCWGG 1 cut(s) 45
BstSCI CCNGG 1 cut(s) 43
Cac8I GCNNGC 3 cut(s) 137, 141, 219
Csp6I GTAC 1 cut(s) 130
CviJI RGCY 7 cut(s) 58, 78, 86, 135, 143, 221, 294
CviKI_1 RGCY 7 cut(s) 58, 78, 86, 135, 143, 221, 294
CviQI GTAC 1 cut(s) 130
DdeI CTNAG 1 cut(s) 247
DpnI GATC 1 cut(s) 167
DpnII GATC 1 cut(s) 165
EcoRII CCWGG 1 cut(s) 43
FaiI YATR 4 cut(s) 11, 83, 116, 170
FalI AAGNNNNNCTT 1 cut(s) 278
HindIII AAGCTT 1 cut(s) 292
HinfI GANTC 2 cut(s) 155, 191
Hpy166II GTNNAC 1 cut(s) 301
Hpy188III TCNNGA 1 cut(s) 159
Hpy8I GTNNAC 1 cut(s) 301
HpyCH4IV ACGT 1 cut(s) 13
HpyCH4V TGCA 4 cut(s) 139, 209, 260, 272
HpyF10VI GCNNNNNNNGC 1 cut(s) 206
HpyF3I CTNAG 1 cut(s) 247
HpySE526I ACGT 1 cut(s) 13
Kzo9I GATC 1 cut(s) 165
LmnI GCTCC 1 cut(s) 205
LpnPI CCDG 4 cut(s) 30, 57, 88, 144
LweI GCATC 2 cut(s) 218, 259
MaeII ACGT 1 cut(s) 13
MalI GATC 1 cut(s) 167
MboI GATC 1 cut(s) 165
MluCI AATT 1 cut(s) 69
MmeI TCCRAC 1 cut(s) 232
MnlI CCTC 1 cut(s) 273
MseI TTAA 1 cut(s) 68
MspR9I CCNGG 1 cut(s) 45
Mva1269I GAATGC 1 cut(s) 10
MvaI CCWGG 1 cut(s) 45
MwoI GCNNNNNNNGC 1 cut(s) 206
NdeII GATC 1 cut(s) 165
NlaIV GGNNCC 1 cut(s) 42
PctI GAATGC 1 cut(s) 10
PfeI GAWTC 2 cut(s) 155, 191
Ppu21I YACGTR 1 cut(s) 14
Psp6I CCWGG 1 cut(s) 43
PspGI CCWGG 1 cut(s) 43
PspN4I GGNNCC 1 cut(s) 42
RsaI GTAC 1 cut(s) 131
RsaNI GTAC 1 cut(s) 130
SaqAI TTAA 1 cut(s) 68
Sau3AI GATC 1 cut(s) 165
ScrFI CCNGG 1 cut(s) 45
SetI ASST 7 cut(s) 16, 49, 88, 137, 145, 223, 296
SfaNI GCATC 2 cut(s) 218, 259
Sse9I AATT 1 cut(s) 69
SsiI CCGC 1 cut(s) 231
SspI AATATT 1 cut(s) 36
StyD4I CCNGG 1 cut(s) 43
TaiI ACGT 1 cut(s) 16
TaqI TCGA 1 cut(s) 194
TasI AATT 1 cut(s) 69
TfiI GAWTC 2 cut(s) 155, 191
Tru1I TTAA 1 cut(s) 68
Tru9I TTAA 1 cut(s) 68
TspDTI ATGAA 3 cut(s) 17, 77, 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.