Rmu_sc0000629.1_g000021

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000629.1
Physical Location & Seq
Forward (+)
82287 .. 84029
1743 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000629.1_g000021.1.cds

Sequence Viewer

Length: 1743 bp
atgatacgctcaagtcctcgtgctgttcttgaaaccacatataggcttgttctatcaaaatccacacacaacttggccacattagaacggacttgctctgatctgttacgtacatgtgcccaatcctccaacttacccaatggcagagcaattcacgcaaaactcttcaaagggtctctgcccttttcgccgttccttcaaaatcatctactcaacatgtatgtcaaatgtggccatctcaacaatgccctccaactgttcgacgaaatgcctgagagaaatgttgtgtcttggtccgcgctcattaaagggtttgtgcaacacggctgccccaatgaagccctgtctttgtttggtcgtatgcacagggatggcaccaccatgcccaatgagttcacattggtcagctccctccaggcatgctccttgtgtgggaatctgactcaagcttatcaggtttacgcattcattgttcgtctcgggttcgagtggaatgtgttcctcactaatgcattgttgactgttttagtaagacatggtgaactaacagaggctctgcaagtgtttgagaactgccccaataaagatatagtgtcttggaatgctatcatggctggctacttggagtatgattgttcagaagtagctacattctggtggagaatgaatcgcgagggagtgacgcccgatagctacacattttcgagtgtgctcactgggttggctggtgtcactgatcttaaaatgggtgtgcaggttcatgcacagcttgtgaggtatggccatggggcggagatttgtgtggggaattccctggctgatatgtatatcaaaaatcatcagttgctggatggtttcaaagcttttcatgagatgcctttaaaagatgtgtgctcatggactgaaatggctgctggctgcctgcaatgtggggaaccaagcaaagcactcgaggttattgctcaaatgaagaaagttgggatacagccaaacaagttcacacttgcaactgccctgaatgcgtgtgccaatctggcttcgttggaggaagggaagaaattccatggtttgagaattaaacttgaaacttgtactgatgtggacatctgtgtagataatgctctgctggacatgtatgcaaaatgtggatgcatggatggtgcacggagtgtttttgagtcgatgaaggatagttctgtagtctcatggaccacaatgataatggggtgcgcacaaaatgggaaggctggagaagctcttgaggtttttgataagatgaggctgcaggaaggcattgagccaaattacatcacctttatttgtgtgctttatgcatgtagccaaggagggtttattgatgagggatggaagtactttgactccatgactcaaaactttggaatcaccccaggagaagaccattatgcatgcatggtggatcttctaggccgtgctggacgtataaaggaagctgaggaattgatcaagaacatgcctttaaaaccaggtgttttggtttggcagactttgcttggtgcttgtcagctgcttggggatacagaaacaggaaggcgagcagcagagcatgcattagagataaacagaacagagccatcaacatatatattgctgtcaaacatttttgctggtttgagccattgggacagcgtcgggatgctgaggaaactaatggactctagggatgtaaagaaattgcctggatccagttggattgaacattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

580

Amino Acids

64.44

Weight (kDa)

6.0

Isoelectric Point (pI)

41.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016305)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g12540 FvH4_4g12540
malus_domestica MD14G1245400.v1.1
prunus_persica Prupe.5G243000_v2.0.a1
pyrus_communis pycom14g20640
rosa_chinensis RchiOBHm_Chr4g0411381
rosa_laevigata RLG00000008361
rosa_multiflora Rmu_sc0000629.1_g000021
rosa_roxburghii Rroxscaffold_5G00355960
rosa_rugosa Rorug04G0109600
rosa_samantha Rh4BG164500 Rh4CG179100 Rh4DG162200
rosa_wichuraiana Rw4G013840 Rw4G013940

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 1231
Acc36I ACCTGC 1 cut(s) 745
AccB1I GGYRCC 1 cut(s) 374
AccII CGCG 2 cut(s) 299, 672
AciI CCGC 2 cut(s) 297, 791
AclWI GGATC 3 cut(s) 1446, 1716, 1729
AcoI YGGCCR 3 cut(s) 75, 232, 781
AcsI RAATTY 2 cut(s) 808, 1058
AcyI GRCGYC 1 cut(s) 683
AdeI CACNNNGTG 1 cut(s) 1169
AfaI GTAC 3 cut(s) 112, 1093, 1373
AfiI CCNNNNNNNGG 3 cut(s) 42, 432, 790
AflIII ACRYGT 3 cut(s) 113, 216, 1131
AgsI TTSAA 6 cut(s) 32, 169, 200, 859, 1085, 1736
AjnI CCWGG 5 cut(s) 414, 813, 1408, 1504, 1717
AluBI AGCT 9 cut(s) 408, 449, 647, 693, 769, 863, 1256, 1472, 1546
AluI AGCT 9 cut(s) 408, 449, 647, 693, 769, 863, 1256, 1472, 1546
Alw21I GWGCWC 3 cut(s) 714, 896, 1165
Alw26I GTCTC 3 cut(s) 180, 482, 1207
Alw44I GTGCAC 1 cut(s) 1161
AlwI GGATC 3 cut(s) 1446, 1716, 1729
AlwNI CAGNNNCTG 1 cut(s) 847
Ama87I CYCGRG 2 cut(s) 479, 950
AoxI GGCC 4 cut(s) 75, 232, 781, 1447
ApaLI GTGCAC 1 cut(s) 1161
ApeKI GCWGC 6 cut(s) 327, 911, 918, 1282, 1546, 1577
ApoI RAATTY 2 cut(s) 808, 1058
Asp700I GAANNNNTTC 2 cut(s) 497, 1058
AspLEI GCGC 2 cut(s) 301, 1232
AspS9I GGNCC 2 cut(s) 294, 1209
AsuHPI GGTGA 3 cut(s) 551, 1303, 1396
AvaI CYCGRG 2 cut(s) 479, 950
AvaII GGWCC 2 cut(s) 294, 1209
BaeGI GKGCMC 2 cut(s) 121, 1165
BalI TGGCCA 3 cut(s) 77, 234, 783
BamHI GGATCC 1 cut(s) 1721
BanI GGYRCC 1 cut(s) 374
BauI CACGAG 1 cut(s) 18
BbsI GAAGAC 1 cut(s) 1422
Bbv12I GWGCWC 3 cut(s) 714, 896, 1165
BbvCI CCTCAGC 2 cut(s) 1473, 1679
BbvI GCAGC 6 cut(s) 314, 898, 905, 1269, 1533, 1589
BccI CCATC 6 cut(s) 243, 365, 845, 1151, 1359, 1621
BceAI ACGGC 3 cut(s) 175, 340, 1434
BcgI CGANNNNNNTGC 4 cut(s) 931, 941, 965, 975
BciT130I CCWGG 5 cut(s) 416, 815, 1410, 1506, 1719
BciVI GTATCC 2 cut(s) 975, 1549
BclI TGATCA 1 cut(s) 1482
BcoDI GTCTC 3 cut(s) 180, 482, 1207
BfaI CTAG 2 cut(s) 1445, 1698
BfmI CTRYAG 2 cut(s) 1197, 1283
BfuAI ACCTGC 1 cut(s) 745
BfuI GTATCC 2 cut(s) 975, 1549
BglI GCCNNNNNGGC 1 cut(s) 1034
BisI GCNGC 6 cut(s) 328, 912, 919, 1283, 1547, 1578
BlsI GCNGC 6 cut(s) 329, 913, 920, 1284, 1548, 1579
BmcAI AGTACT 1 cut(s) 1373
Bme1390I CCNGG 5 cut(s) 416, 815, 1410, 1506, 1719
Bme18I GGWCC 2 cut(s) 294, 1209
BmeT110I CYCGRG 2 cut(s) 479, 950
BmgT120I GGNCC 2 cut(s) 294, 1209
BmiI GGNNCC 3 cut(s) 376, 936, 1723
BmrFI CCNGG 5 cut(s) 416, 815, 1410, 1506, 1719
BmrI ACTGGG 1 cut(s) 726
BmsI GCATC 3 cut(s) 864, 1139, 1665
BmuI ACTGGG 1 cut(s) 726
BpiI GAAGAC 1 cut(s) 1422
BpmI CTGGAG 2 cut(s) 398, 1269
Bpu10I CCTNAGC 2 cut(s) 1473, 1679
BpuEI CTTGAG 2 cut(s) 429, 1280
BsaAI YACGTR 1 cut(s) 110
BsaHI GRCGYC 1 cut(s) 683
BsaI GGTCTC 1 cut(s) 180
BsaJI CCNNGG 5 cut(s) 784, 813, 1063, 1342, 1408
BsaXI ACNNNNNCTCC 2 cut(s) 1364, 1394
Bsc4I CCNNNNNNNGG 3 cut(s) 42, 432, 790
Bse1I ACTGG 2 cut(s) 721, 1725
Bse3DI GCAATG 1 cut(s) 932
BseBI CCWGG 5 cut(s) 416, 815, 1410, 1506, 1719
BseDI CCNNGG 5 cut(s) 784, 813, 1063, 1342, 1408
BseGI GGATG 7 cut(s) 376, 856, 1154, 1162, 1370, 1680, 1708
BseLI CCNNNNNNNGG 3 cut(s) 42, 432, 790
BseMI GCAATG 1 cut(s) 932
BseMII CTCAG 3 cut(s) 264, 1464, 1670
BseNI ACTGG 2 cut(s) 721, 1725
BseSI GKGCMC 2 cut(s) 121, 1165
BseXI GCAGC 6 cut(s) 314, 898, 905, 1269, 1533, 1589
BsgI GTGCAG 1 cut(s) 773
Bsh1236I CGCG 2 cut(s) 299, 672
BshFI GGCC 4 cut(s) 77, 234, 783, 1449
BshNI GGYRCC 1 cut(s) 374
BsiHKAI GWGCWC 3 cut(s) 714, 896, 1165
BsiHKCI CYCGRG 2 cut(s) 479, 950
BslFI GGGAC 1 cut(s) 1676
BslI CCNNNNNNNGG 3 cut(s) 42, 432, 790
BsmAI GTCTC 3 cut(s) 180, 482, 1207
BsmBI CGTCTC 1 cut(s) 482
BsmFI GGGAC 1 cut(s) 1676
BsmI GAATGC 3 cut(s) 464, 607, 1024
BsnI GGCC 4 cut(s) 77, 234, 783, 1449
Bso31I GGTCTC 1 cut(s) 180
BsoBI CYCGRG 2 cut(s) 479, 950
Bsp1286I GDGCHC 4 cut(s) 121, 714, 896, 1165
Bsp143I GATC 5 cut(s) 100, 736, 1438, 1482, 1721
Bsp19I CCATGG 2 cut(s) 784, 1063
Bsp68I TCGCGA 1 cut(s) 672
BspACI CCGC 2 cut(s) 297, 791
BspANI GGCC 4 cut(s) 77, 234, 783, 1449
BspCNI CTCAG 3 cut(s) 265, 1465, 1671
BspFNI CGCG 2 cut(s) 299, 672
BspHI TCATGA 1 cut(s) 868
BspLI GGNNCC 3 cut(s) 376, 936, 1723
BspMAI CTGCAG 1 cut(s) 1287
BspMI ACCTGC 1 cut(s) 745
BspPI GGATC 3 cut(s) 1446, 1716, 1729
BspT107I GGYRCC 1 cut(s) 374
BspTNI GGTCTC 1 cut(s) 180
BsrDI GCAATG 1 cut(s) 932
BsrI ACTGG 2 cut(s) 721, 1725
BssECI CCNNGG 5 cut(s) 784, 813, 1063, 1342, 1408
BssMI GATC 5 cut(s) 100, 736, 1438, 1482, 1721
BssNI GRCGYC 1 cut(s) 683
BssSI CACGAG 1 cut(s) 18
BssT1I CCWWGG 3 cut(s) 784, 1063, 1342
Bst2BI CACGAG 1 cut(s) 18
Bst2UI CCWGG 5 cut(s) 416, 815, 1410, 1506, 1719
Bst4CI ACNGT 2 cut(s) 258, 523
Bst6I CTCTTC 1 cut(s) 170
BstACI GRCGYC 1 cut(s) 683
BstAPI GCANNNNNTGC 2 cut(s) 1528, 1586
BstBAI YACGTR 1 cut(s) 110
BstC8I GCNNGC 7 cut(s) 421, 616, 916, 923, 1429, 1575, 1587
BstDEI CTNAG 3 cut(s) 273, 1473, 1679
BstDSI CCRYGG 2 cut(s) 784, 1063
BstF5I GGATG 7 cut(s) 376, 856, 1154, 1162, 1370, 1680, 1708
BstFNI CGCG 2 cut(s) 299, 672
BstHHI GCGC 2 cut(s) 301, 1232
BstKTI GATC 5 cut(s) 103, 739, 1441, 1485, 1724
BstMAI GTCTC 3 cut(s) 180, 482, 1207
BstMBI GATC 5 cut(s) 100, 736, 1438, 1482, 1721
BstMWI GCNNNNNNNGC 8 cut(s) 155, 187, 611, 1019, 1034, 1253, 1528, 1586
BstNI CCWGG 5 cut(s) 416, 815, 1410, 1506, 1719
BstNSI RCATGY 8 cut(s) 117, 220, 423, 1135, 1338, 1431, 1495, 1589
BstSCI CCNGG 5 cut(s) 414, 813, 1408, 1504, 1717
BstSFI CTRYAG 2 cut(s) 1197, 1283
BstSLI GKGCMC 2 cut(s) 121, 1165
BstSNI TACGTA 1 cut(s) 110
BstUI CGCG 2 cut(s) 299, 672
BstV1I GCAGC 6 cut(s) 314, 898, 905, 1269, 1533, 1589
BstV2I GAAGAC 1 cut(s) 1422
BstX2I RGATCY 2 cut(s) 1438, 1721
BstYI RGATCY 2 cut(s) 1438, 1721
BsuI GTATCC 2 cut(s) 975, 1549
BsuRI GGCC 4 cut(s) 77, 234, 783, 1449
BtgI CCRYGG 2 cut(s) 784, 1063
BtsCI GGATG 7 cut(s) 376, 856, 1154, 1162, 1370, 1680, 1708
BtsIMutI CAGTG 2 cut(s) 714, 732
BtuMI TCGCGA 1 cut(s) 672
BveI ACCTGC 1 cut(s) 745
Cac8I GCNNGC 7 cut(s) 421, 616, 916, 923, 1429, 1575, 1587
CaiI CAGNNNCTG 1 cut(s) 847
CciI TCATGA 1 cut(s) 868
CfoI GCGC 2 cut(s) 301, 1232
Cfr13I GGNCC 2 cut(s) 294, 1209
CseI GACGC 2 cut(s) 691, 1657
CsiI ACCWGGT 1 cut(s) 1504
Csp6I GTAC 3 cut(s) 111, 1092, 1372
CviQI GTAC 3 cut(s) 111, 1092, 1372
DdeI CTNAG 3 cut(s) 273, 1473, 1679
DpnI GATC 5 cut(s) 102, 738, 1440, 1484, 1723
DpnII GATC 5 cut(s) 100, 736, 1438, 1482, 1721
DraI TTTAAA 2 cut(s) 882, 1500
DraIII CACNNNGTG 1 cut(s) 1169
EaeI YGGCCR 3 cut(s) 75, 232, 781
Eam1104I CTCTTC 1 cut(s) 170
EarI CTCTTC 1 cut(s) 170
EciI GGCGGA 1 cut(s) 806
Eco105I TACGTA 1 cut(s) 110
Eco130I CCWWGG 3 cut(s) 784, 1063, 1342
Eco31I GGTCTC 1 cut(s) 180
Eco47I GGWCC 2 cut(s) 294, 1209
Eco88I CYCGRG 2 cut(s) 479, 950
EcoRI GAATTC 1 cut(s) 808
EcoRII CCWGG 5 cut(s) 414, 813, 1408, 1504, 1717
EcoT14I CCWWGG 3 cut(s) 784, 1063, 1342
EcoT22I ATGCAT 6 cut(s) 514, 1154, 1336, 1429, 1433, 1591
ErhI CCWWGG 3 cut(s) 784, 1063, 1342
Esp3I CGTCTC 1 cut(s) 482
FaqI GGGAC 1 cut(s) 1676
FbaI TGATCA 1 cut(s) 1482
Fnu4HI GCNGC 6 cut(s) 328, 912, 919, 1283, 1547, 1578
FokI GGATG 7 cut(s) 383, 863, 1161, 1169, 1377, 1687, 1715
Fsp4HI GCNGC 6 cut(s) 328, 912, 919, 1283, 1547, 1578
FspAI RTGCGCAY 1 cut(s) 1231
FspBI CTAG 2 cut(s) 1445, 1698
FspI TGCGCA 1 cut(s) 1231
GlaI GCGC 2 cut(s) 300, 1231
GluI GCNGC 6 cut(s) 328, 912, 919, 1283, 1547, 1578
GsuI CTGGAG 2 cut(s) 398, 1269
HaeIII GGCC 4 cut(s) 77, 234, 783, 1449
HgaI GACGC 2 cut(s) 691, 1657
HhaI GCGC 2 cut(s) 301, 1232
Hin1I GRCGYC 1 cut(s) 683
Hin6I GCGC 2 cut(s) 299, 1230
HinP1I GCGC 2 cut(s) 299, 1230
HincII GTYRAC 1 cut(s) 519
HindII GTYRAC 1 cut(s) 519
HindIII AAGCTT 2 cut(s) 447, 861
HinfI GANTC 8 cut(s) 436, 442, 667, 1178, 1379, 1387, 1401, 1694
HphI GGTGA 3 cut(s) 551, 1303, 1396
Hpy166II GTNNAC 7 cut(s) 396, 460, 519, 542, 999, 1102, 1163
Hpy188I TCNGA 3 cut(s) 100, 441, 640
Hpy188III TCNNGA 6 cut(s) 29, 671, 869, 1259, 1486, 1672
Hpy8I GTNNAC 7 cut(s) 396, 460, 519, 542, 999, 1102, 1163
Hpy99I CGWCG 2 cut(s) 266, 1673
HpyAV CCTTC 6 cut(s) 206, 1043, 1180, 1237, 1283, 1563
HpyCH4III ACNGT 2 cut(s) 258, 523
HpyCH4IV ACGT 2 cut(s) 109, 1459
HpyF10VI GCNNNNNNNGC 8 cut(s) 155, 187, 611, 1019, 1034, 1253, 1528, 1586
HpyF3I CTNAG 3 cut(s) 273, 1473, 1679
HpySE526I ACGT 2 cut(s) 109, 1459
Hsp92I GRCGYC 1 cut(s) 683
HspAI GCGC 2 cut(s) 299, 1230
Ksp22I TGATCA 1 cut(s) 1482
Kzo9I GATC 5 cut(s) 100, 736, 1438, 1482, 1721
LmnI GCTCC 2 cut(s) 413, 428
Lsp1109I GCAGC 6 cut(s) 314, 898, 905, 1269, 1533, 1589
LweI GCATC 3 cut(s) 864, 1139, 1665
MabI ACCWGGT 1 cut(s) 1504
MaeI CTAG 2 cut(s) 1445, 1698
MaeII ACGT 2 cut(s) 109, 1459
MaeIII GTNAC 3 cut(s) 105, 679, 730
MalI GATC 5 cut(s) 102, 738, 1440, 1484, 1723
MboI GATC 5 cut(s) 100, 736, 1438, 1482, 1721
MboII GAAGA 5 cut(s) 157, 982, 1066, 1427, 1433
MflI RGATCY 2 cut(s) 1438, 1721
MhlI GDGCHC 4 cut(s) 121, 714, 896, 1165
MlsI TGGCCA 3 cut(s) 77, 234, 783
MluCI AATT 7 cut(s) 150, 808, 1058, 1074, 1303, 1478, 1712
MluNI TGGCCA 3 cut(s) 77, 234, 783
MlyI GAGTC 5 cut(s) 436, 1187, 1373, 1381, 1688
MmeI TCCRAC 4 cut(s) 153, 277, 1023, 1709
Mox20I TGGCCA 3 cut(s) 77, 234, 783
Mph1103I ATGCAT 6 cut(s) 514, 1154, 1336, 1429, 1433, 1591
MroXI GAANNNNTTC 2 cut(s) 497, 1058
MscI TGGCCA 3 cut(s) 77, 234, 783
MseI TTAA 5 cut(s) 306, 741, 881, 1077, 1499
MslI CAYNNNNRTG 3 cut(s) 369, 380, 655
Msp20I TGGCCA 3 cut(s) 77, 234, 783
MspA1I CMGCKG 1 cut(s) 1546
MspR9I CCNGG 5 cut(s) 416, 815, 1410, 1506, 1719
Mva1269I GAATGC 3 cut(s) 464, 607, 1024
MvaI CCWGG 5 cut(s) 416, 815, 1410, 1506, 1719
MvnI CGCG 2 cut(s) 299, 672
MwoI GCNNNNNNNGC 8 cut(s) 155, 187, 611, 1019, 1034, 1253, 1528, 1586
NcoI CCATGG 2 cut(s) 784, 1063
NdeII GATC 5 cut(s) 100, 736, 1438, 1482, 1721
NlaIV GGNNCC 3 cut(s) 376, 936, 1723
NmuCI GTSAC 2 cut(s) 679, 730
NruI TCGCGA 1 cut(s) 672
NsbI TGCGCA 1 cut(s) 1231
NsiI ATGCAT 6 cut(s) 514, 1154, 1336, 1429, 1433, 1591
NspI RCATGY 8 cut(s) 117, 220, 423, 1135, 1338, 1431, 1495, 1589
PaeI GCATGC 3 cut(s) 423, 1431, 1589
PaeR7I CTCGAG 1 cut(s) 950
PagI TCATGA 1 cut(s) 868
PciI ACATGT 3 cut(s) 113, 216, 1131
PctI GAATGC 3 cut(s) 464, 607, 1024
PdmI GAANNNNTTC 2 cut(s) 497, 1058
PfeI GAWTC 3 cut(s) 436, 667, 1401
PflFI GACNNNGTC 1 cut(s) 1667
PkrI GCNGC 6 cut(s) 329, 913, 920, 1284, 1548, 1579
PleI GAGTC 5 cut(s) 436, 1186, 1373, 1381, 1688
PpsI GAGTC 5 cut(s) 436, 1186, 1373, 1381, 1688
Ppu21I YACGTR 1 cut(s) 110
PscI ACATGT 3 cut(s) 113, 216, 1131
Psp6I CCWGG 5 cut(s) 414, 813, 1408, 1504, 1717
PspGI CCWGG 5 cut(s) 414, 813, 1408, 1504, 1717
PspN4I GGNNCC 3 cut(s) 376, 936, 1723
PspPI GGNCC 2 cut(s) 294, 1209
PspXI VCTCGAGB 1 cut(s) 950
PstI CTGCAG 1 cut(s) 1287
PstNI CAGNNNCTG 1 cut(s) 847
PsuI RGATCY 2 cut(s) 1438, 1721
PsyI GACNNNGTC 1 cut(s) 1667
PvuII CAGCTG 1 cut(s) 1546
RruI TCGCGA 1 cut(s) 672
RsaI GTAC 3 cut(s) 112, 1093, 1373
RsaNI GTAC 3 cut(s) 111, 1092, 1372
RseI CAYNNNNRTG 3 cut(s) 369, 380, 655
SaqAI TTAA 5 cut(s) 306, 741, 881, 1077, 1499
SatI GCNGC 6 cut(s) 328, 912, 919, 1283, 1547, 1578
Sau3AI GATC 5 cut(s) 100, 736, 1438, 1482, 1721
Sau96I GGNCC 2 cut(s) 294, 1209
ScaI AGTACT 1 cut(s) 1373
SchI GAGTC 5 cut(s) 436, 1187, 1373, 1381, 1688
ScrFI CCNGG 5 cut(s) 416, 815, 1410, 1506, 1719
SduI GDGCHC 4 cut(s) 121, 714, 896, 1165
SexAI ACCWGGT 1 cut(s) 1504
SfaNI GCATC 3 cut(s) 864, 1139, 1665
SfcI CTRYAG 2 cut(s) 1197, 1283
Sfr274I CTCGAG 1 cut(s) 950
SinI GGWCC 2 cut(s) 294, 1209
SlaI CTCGAG 1 cut(s) 950
SmiMI CAYNNNNRTG 3 cut(s) 369, 380, 655
SmlI CTYRAG 4 cut(s) 10, 444, 950, 1259
SmoI CTYRAG 4 cut(s) 10, 444, 950, 1259
SnaBI TACGTA 1 cut(s) 110
SphI GCATGC 3 cut(s) 423, 1431, 1589
Sse9I AATT 7 cut(s) 150, 808, 1058, 1074, 1303, 1478, 1712
SsiI CCGC 2 cut(s) 297, 791
SspMI CTAG 2 cut(s) 1445, 1698
StyD4I CCNGG 5 cut(s) 414, 813, 1408, 1504, 1717
StyI CCWWGG 3 cut(s) 784, 1063, 1342
TaaI ACNGT 2 cut(s) 258, 523
TaiI ACGT 2 cut(s) 112, 1462
TaqI TCGA 5 cut(s) 261, 486, 704, 951, 1181
TasI AATT 7 cut(s) 150, 808, 1058, 1074, 1303, 1478, 1712
TatI WGTACW 2 cut(s) 1091, 1371
TfiI GAWTC 3 cut(s) 436, 667, 1401
Tru1I TTAA 5 cut(s) 306, 741, 881, 1077, 1499
Tru9I TTAA 5 cut(s) 306, 741, 881, 1077, 1499
TscAI CASTG 2 cut(s) 721, 739
TseFI GTSAC 2 cut(s) 679, 730
TseI GCWGC 6 cut(s) 327, 911, 918, 1282, 1546, 1577
Tsp45I GTSAC 2 cut(s) 679, 730
TspDTI ATGAA 7 cut(s) 351, 457, 680, 749, 857, 983, 1199
TspGWI ACGGA 2 cut(s) 103, 1180
TspRI CASTG 2 cut(s) 721, 739
Tth111I GACNNNGTC 1 cut(s) 1667
VneI GTGCAC 1 cut(s) 1161
VpaK11BI GGWCC 2 cut(s) 294, 1209
XapI RAATTY 2 cut(s) 808, 1058
XceI RCATGY 8 cut(s) 117, 220, 423, 1135, 1338, 1431, 1495, 1589
XcmI CCANNNNNNNNNTGG 2 cut(s) 70, 1219
XhoI CTCGAG 1 cut(s) 950
XmnI GAANNNNTTC 2 cut(s) 497, 1058
XspI CTAG 2 cut(s) 1445, 1698
ZrmI AGTACT 1 cut(s) 1373
Zsp2I ATGCAT 6 cut(s) 514, 1154, 1336, 1429, 1433, 1591
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.