Rmu_sc0000642.1_g000003

Costars family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000642.1
Physical Location & Seq
Forward (+)
7538 .. 11306
3769 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000642.1_g000003.1.cds

Sequence Viewer

Length: 288 bp
atgaatgtagaagaagaggtcgagcgtctcaaagaagaaatcaaaaggcttggcaaggtccaagacgatggttcttacaaggtcacatttggtgtgttatttaatgatgatagatgcgcaaacatatttgaagctttggttggaacactaagagctgcaaagaggcggaaacttctcacatatgaaggtgagcttctgctccaaggagttcatgacaatgtggaaatcatactcaaacccaccccagcagcagcgactgaggtaactaatgcaggcgagaagagttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

95

Amino Acids

10.6

Weight (kDa)

5.2

Isoelectric Point (pI)

41.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016154)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G33640
fragaria_vesca FvH4_2g11550
malus_domestica MD05G1048500.v1.1 MD10G1054900.v1.1
prunus_persica Prupe.8G071000_v2.0.a1
pyrus_communis pycom05g04010 pycom10g04190
rosa_chinensis RchiOBHm_Chr6g0270691
rosa_multiflora Rmu_sc0000642.1_g000003
rosa_roxburghii Rroxscaffold_7G00197680
rosa_rugosa Rorug06G0055900
rosa_samantha Rh6AG175100 Rh6BG178500 Rh6DG166900
rosa_wichuraiana Rw6G014920

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 118
AciI CCGC 1 cut(s) 166
AgsI TTSAA 1 cut(s) 131
AjuI GAANNNNNNNTTGG 2 cut(s) 123, 155
AluBI AGCT 3 cut(s) 134, 155, 193
AluI AGCT 3 cut(s) 134, 155, 193
Alw26I GTCTC 1 cut(s) 32
AlwNI CAGNNNCTG 1 cut(s) 257
ApeKI GCWGC 3 cut(s) 155, 248, 251
AspLEI GCGC 1 cut(s) 119
AspS9I GGNCC 1 cut(s) 58
AsuHPI GGTGA 1 cut(s) 200
AvaII GGWCC 1 cut(s) 58
BbvI GCAGC 3 cut(s) 142, 260, 263
BccI CCATC 1 cut(s) 62
BcoDI GTCTC 1 cut(s) 32
BisI GCNGC 3 cut(s) 156, 249, 252
BlsI GCNGC 3 cut(s) 157, 250, 253
Bme18I GGWCC 1 cut(s) 58
BmgT120I GGNCC 1 cut(s) 58
BmsI GCATC 1 cut(s) 104
BsaJI CCNNGG 1 cut(s) 202
BseDI CCNNGG 1 cut(s) 202
BseMII CTCAG 1 cut(s) 249
BseXI GCAGC 3 cut(s) 142, 260, 263
BseYI CCCAGC 1 cut(s) 244
BsmAI GTCTC 1 cut(s) 32
BsmBI CGTCTC 1 cut(s) 32
BspACI CCGC 1 cut(s) 166
BspCNI CTCAG 1 cut(s) 250
BspHI TCATGA 1 cut(s) 211
BssECI CCNNGG 1 cut(s) 202
BssT1I CCWWGG 1 cut(s) 202
Bst6I CTCTTC 2 cut(s) 9, 275
BstC8I GCNNGC 1 cut(s) 274
BstDEI CTNAG 2 cut(s) 149, 258
BstHHI GCGC 1 cut(s) 119
BstMAI GTCTC 1 cut(s) 32
BstV1I GCAGC 3 cut(s) 142, 260, 263
BstXI CCANNNNNNTGG 1 cut(s) 68
Cac8I GCNNGC 1 cut(s) 274
CaiI CAGNNNCTG 1 cut(s) 257
CciI TCATGA 1 cut(s) 211
CfoI GCGC 1 cut(s) 119
Cfr13I GGNCC 1 cut(s) 58
CseI GACGC 1 cut(s) 14
CviAII CATG 1 cut(s) 212
CviJI RGCY 4 cut(s) 49, 134, 155, 193
CviKI_1 RGCY 4 cut(s) 49, 134, 155, 193
DdeI CTNAG 2 cut(s) 149, 258
Eam1104I CTCTTC 2 cut(s) 9, 275
EarI CTCTTC 2 cut(s) 9, 275
EciI GGCGGA 1 cut(s) 181
Eco130I CCWWGG 1 cut(s) 202
Eco47I GGWCC 1 cut(s) 58
EcoT14I CCWWGG 1 cut(s) 202
ErhI CCWWGG 1 cut(s) 202
Esp3I CGTCTC 1 cut(s) 32
FaeI CATG 1 cut(s) 215
FaiI YATR 5 cut(s) 125, 181, 183, 213, 230
FalI AAGNNNNNCTT 2 cut(s) 177, 209
FatI CATG 1 cut(s) 211
FauNDI CATATG 1 cut(s) 181
Fnu4HI GCNGC 3 cut(s) 156, 249, 252
Fsp4HI GCNGC 3 cut(s) 156, 249, 252
FspI TGCGCA 1 cut(s) 118
GlaI GCGC 1 cut(s) 118
GluI GCNGC 3 cut(s) 156, 249, 252
GsaI CCCAGC 1 cut(s) 248
HgaI GACGC 1 cut(s) 14
HhaI GCGC 1 cut(s) 119
Hin1II CATG 1 cut(s) 215
Hin6I GCGC 1 cut(s) 117
HinP1I GCGC 1 cut(s) 117
HindIII AAGCTT 1 cut(s) 132
HphI GGTGA 1 cut(s) 200
Hpy188III TCNNGA 1 cut(s) 212
HpyAV CCTTC 1 cut(s) 179
HpyCH4V TGCA 2 cut(s) 158, 272
HpyF3I CTNAG 2 cut(s) 149, 258
Hsp92II CATG 1 cut(s) 215
HspAI GCGC 1 cut(s) 117
LmnI GCTCC 1 cut(s) 204
LpnPI CCDG 2 cut(s) 258, 258
Lsp1109I GCAGC 3 cut(s) 142, 260, 263
LweI GCATC 1 cut(s) 104
MaeIII GTNAC 2 cut(s) 82, 262
MboII GAAGA 3 cut(s) 23, 26, 47
MmeI TCCRAC 1 cut(s) 121
MnlI CCTC 3 cut(s) 10, 156, 253
MseI TTAA 1 cut(s) 102
MslI CAYNNNNRTG 1 cut(s) 216
NdeI CATATG 1 cut(s) 181
NlaIII CATG 1 cut(s) 215
NmuCI GTSAC 1 cut(s) 82
NsbI TGCGCA 1 cut(s) 118
PagI TCATGA 1 cut(s) 211
PkrI GCNGC 3 cut(s) 157, 250, 253
PspFI CCCAGC 1 cut(s) 244
PspPI GGNCC 1 cut(s) 58
PstNI CAGNNNCTG 1 cut(s) 257
RseI CAYNNNNRTG 1 cut(s) 216
SaqAI TTAA 1 cut(s) 102
SatI GCNGC 3 cut(s) 156, 249, 252
Sau96I GGNCC 1 cut(s) 58
SetI ASST 8 cut(s) 21, 60, 84, 136, 157, 190, 195, 264
SfaNI GCATC 1 cut(s) 104
SgeI CNNG 8 cut(s) 34, 62, 67, 74, 91, 215, 224, 257
SinI GGWCC 1 cut(s) 58
SmiMI CAYNNNNRTG 1 cut(s) 216
SsiI CCGC 1 cut(s) 166
StyI CCWWGG 1 cut(s) 202
TaqI TCGA 1 cut(s) 21
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TseFI GTSAC 1 cut(s) 82
TseI GCWGC 3 cut(s) 155, 248, 251
Tsp45I GTSAC 1 cut(s) 82
TspDTI ATGAA 3 cut(s) 17, 198, 200
VpaK11BI GGWCC 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.