Rmu_sc0000698.1_g000044

DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000698.1
Physical Location & Seq
Forward (+)
217250 .. 217561
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000698.1_g000044.1.cds

Sequence Viewer

Length: 312 bp
atgtttggtgagatcgaccactgccttatagcccatggagcatcagcaaacttatatgaacaccctttgactcttagtgactcctcccaaacgcatgcttgccagaaatgcaaaaatgcggctaatgtgatagatggaatagttgatggcagtagaatcaggggtccatattgccgggtctgtaagtgtgttgatgacattgtcaggttgaatgttccatatggggccaagttaggggtcgtcaacgggccgggccaggcccggccaggcccattcatagcgggcttgggccgggccttgctatatttttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component

Protein Analysis

103

Amino Acids

10.98

Weight (kDa)

8.26

Isoelectric Point (pI)

14.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 119, 281
AcoI YGGCCR 1 cut(s) 263
AfiI CCNNNNNNNGG 1 cut(s) 234
AgsI TTSAA 1 cut(s) 211
AjnI CCWGG 2 cut(s) 255, 265
AoxI GGCC 8 cut(s) 225, 248, 253, 258, 263, 268, 289, 294
AspS9I GGNCC 8 cut(s) 164, 225, 248, 253, 259, 269, 289, 294
AsuC2I CCSGG 4 cut(s) 176, 252, 262, 293
AsuHPI GGTGA 1 cut(s) 20
AvaII GGWCC 1 cut(s) 164
BccI CCATC 2 cut(s) 128, 140
BciT130I CCWGG 2 cut(s) 257, 267
BcnI CCSGG 4 cut(s) 176, 252, 262, 293
BisI GCNGC 1 cut(s) 120
BlsI GCNGC 1 cut(s) 121
Bme1390I CCNGG 6 cut(s) 176, 252, 257, 262, 267, 293
Bme18I GGWCC 1 cut(s) 164
BmgT120I GGNCC 8 cut(s) 164, 225, 248, 253, 259, 269, 289, 294
BmiI GGNNCC 2 cut(s) 165, 226
BmrFI CCNGG 6 cut(s) 176, 252, 257, 262, 267, 293
BmsI GCATC 1 cut(s) 50
BpuMI CCSGG 4 cut(s) 176, 252, 262, 293
BsaJI CCNNGG 1 cut(s) 34
Bsc4I CCNNNNNNNGG 1 cut(s) 234
BseBI CCWGG 2 cut(s) 257, 267
BseDI CCNNGG 1 cut(s) 34
BseLI CCNNNNNNNGG 1 cut(s) 234
BseRI GAGGAG 1 cut(s) 73
BshFI GGCC 8 cut(s) 227, 250, 255, 260, 265, 270, 291, 296
BsiSI CCGG 4 cut(s) 175, 251, 262, 292
BslI CCNNNNNNNGG 1 cut(s) 234
BsnI GGCC 8 cut(s) 227, 250, 255, 260, 265, 270, 291, 296
Bsp143I GATC 1 cut(s) 12
Bsp19I CCATGG 1 cut(s) 34
BspACI CCGC 2 cut(s) 119, 281
BspANI GGCC 8 cut(s) 227, 250, 255, 260, 265, 270, 291, 296
BspLI GGNNCC 2 cut(s) 165, 226
BssECI CCNNGG 1 cut(s) 34
BssMI GATC 1 cut(s) 12
BssT1I CCWWGG 1 cut(s) 34
Bst2UI CCWGG 2 cut(s) 257, 267
BstC8I GCNNGC 3 cut(s) 96, 100, 283
BstDEI CTNAG 1 cut(s) 74
BstDSI CCRYGG 1 cut(s) 34
BstKTI GATC 1 cut(s) 15
BstMBI GATC 1 cut(s) 12
BstMWI GCNNNNNNNGC 2 cut(s) 38, 108
BstNI CCWGG 2 cut(s) 257, 267
BstNSI RCATGY 1 cut(s) 98
BstSCI CCNGG 6 cut(s) 174, 250, 255, 260, 265, 291
BsuRI GGCC 8 cut(s) 227, 250, 255, 260, 265, 270, 291, 296
BtgI CCRYGG 1 cut(s) 34
BtsI GCAGTG 1 cut(s) 19
BtsIMutI CAGTG 1 cut(s) 19
Cac8I GCNNGC 3 cut(s) 96, 100, 283
Cfr13I GGNCC 8 cut(s) 164, 225, 248, 253, 259, 269, 289, 294
CviAII CATG 2 cut(s) 35, 95
DdeI CTNAG 1 cut(s) 74
DpnI GATC 1 cut(s) 14
DpnII GATC 1 cut(s) 12
EaeI YGGCCR 1 cut(s) 263
Eco130I CCWWGG 1 cut(s) 34
Eco47I GGWCC 1 cut(s) 164
EcoRII CCWGG 2 cut(s) 255, 265
EcoT14I CCWWGG 1 cut(s) 34
ErhI CCWWGG 1 cut(s) 34
FaeI CATG 2 cut(s) 38, 98
FatI CATG 2 cut(s) 34, 94
FauI CCCGC 1 cut(s) 274
FauNDI CATATG 1 cut(s) 220
Fnu4HI GCNGC 1 cut(s) 120
Fsp4HI GCNGC 1 cut(s) 120
GluI GCNGC 1 cut(s) 120
HaeIII GGCC 8 cut(s) 227, 250, 255, 260, 265, 270, 291, 296
HapII CCGG 4 cut(s) 175, 251, 262, 292
Hin1II CATG 2 cut(s) 38, 98
HincII GTYRAC 1 cut(s) 244
HindII GTYRAC 1 cut(s) 244
HinfI GANTC 3 cut(s) 70, 80, 156
HpaII CCGG 4 cut(s) 175, 251, 262, 292
HphI GGTGA 1 cut(s) 20
Hpy166II GTNNAC 1 cut(s) 244
Hpy8I GTNNAC 1 cut(s) 244
HpyCH4V TGCA 1 cut(s) 111
HpyF10VI GCNNNNNNNGC 2 cut(s) 38, 108
HpyF3I CTNAG 1 cut(s) 74
Hsp92II CATG 2 cut(s) 38, 98
Kzo9I GATC 1 cut(s) 12
LmnI GCTCC 1 cut(s) 38
LweI GCATC 1 cut(s) 50
MaeIII GTNAC 1 cut(s) 77
MalI GATC 1 cut(s) 14
MboI GATC 1 cut(s) 12
MlyI GAGTC 2 cut(s) 64, 74
MnlI CCTC 1 cut(s) 94
MseI TTAA 1 cut(s) 310
MspI CCGG 4 cut(s) 175, 251, 262, 292
MspR9I CCNGG 6 cut(s) 176, 252, 257, 262, 267, 293
MvaI CCWGG 2 cut(s) 257, 267
MwoI GCNNNNNNNGC 2 cut(s) 38, 108
NciI CCSGG 4 cut(s) 176, 252, 262, 293
NcoI CCATGG 1 cut(s) 34
NdeI CATATG 1 cut(s) 220
NdeII GATC 1 cut(s) 12
NlaIII CATG 2 cut(s) 38, 98
NlaIV GGNNCC 2 cut(s) 165, 226
NmuCI GTSAC 1 cut(s) 77
NspI RCATGY 1 cut(s) 98
PaeI GCATGC 1 cut(s) 98
PfeI GAWTC 1 cut(s) 156
PflFI GACNNNGTC 1 cut(s) 200
PkrI GCNGC 1 cut(s) 121
PleI GAGTC 2 cut(s) 64, 74
PpsI GAGTC 2 cut(s) 64, 74
Psp6I CCWGG 2 cut(s) 255, 265
PspGI CCWGG 2 cut(s) 255, 265
PspN4I GGNNCC 2 cut(s) 165, 226
PspPI GGNCC 8 cut(s) 164, 225, 248, 253, 259, 269, 289, 294
PsyI GACNNNGTC 1 cut(s) 200
SaqAI TTAA 1 cut(s) 310
SatI GCNGC 1 cut(s) 120
Sau3AI GATC 1 cut(s) 12
Sau96I GGNCC 8 cut(s) 164, 225, 248, 253, 259, 269, 289, 294
SchI GAGTC 2 cut(s) 64, 74
ScrFI CCNGG 6 cut(s) 176, 252, 257, 262, 267, 293
SetI ASST 1 cut(s) 209
SfaNI GCATC 1 cut(s) 50
SinI GGWCC 1 cut(s) 164
SphI GCATGC 1 cut(s) 98
SsiI CCGC 2 cut(s) 119, 281
StyD4I CCNGG 6 cut(s) 174, 250, 255, 260, 265, 291
StyI CCWWGG 1 cut(s) 34
TaqI TCGA 1 cut(s) 15
TauI GCSGC 1 cut(s) 122
TfiI GAWTC 1 cut(s) 156
Tru1I TTAA 1 cut(s) 310
Tru9I TTAA 1 cut(s) 310
TscAI CASTG 1 cut(s) 26
TseFI GTSAC 1 cut(s) 77
Tsp45I GTSAC 1 cut(s) 77
TspDTI ATGAA 2 cut(s) 72, 265
TspRI CASTG 1 cut(s) 26
Tth111I GACNNNGTC 1 cut(s) 200
VpaK11BI GGWCC 1 cut(s) 164
XceI RCATGY 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.