Rmu_sc0001428.1_g000025

oxidation-reduction process

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001428.1
OG0018682
Physical Location & Seq
Reverse (-)
96339 .. 98168
1830 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001428.1_g000025.1.cds

Sequence Viewer

Length: 828 bp
atgcgccgcttgccgaaaggaggccaggggttggatggaccagtctatagttggatggagtcaccggtgacgaggttgcagcggtgtaggtcaggttgctgcccagaactgtctaggttgcctccagcctccgtcgggcaagccccaagccgccgtcgccgcttgaaaagcagtagaagcgtcgacggcctcagtatccatatacaccaccgttctcacaatcccatccctttcgaacccatcgtcgccgacatcaagtggtgccgcgaggaccgcaaatgggagaatttgcacttggatcgagactccacccccaccgctgagttccaacatgagtggaaggatttcatggagacgttcaatgtcaccaaatggccgttggtcttgttgttccccaagattgatgtcgaccccgtcgatggctttatcaacgagtacgagttaactcagtggatcttggtaggaaaacaaccagcccaacgcaagcataacatatcaaatcccaaccagagaagcaagagattgccccaaaccaaatttcagaaccatgccgtgaagctggtagctcgtggggtgcgcgtgaactgcgtgtcgccgggtttggtggggacgccgctgttgagcgagacttttaagcttggggaggtagagctgaaggagatgatgacagcggtttattcagaaagcaacgatgggccgctgaaggagaaacacgtggcggatgcggtggtgtttttggtgtcggaggacttggctttcgtcaccagccataatttggtggttgatgggggatttggcaccaagtccttatcactactcaaaccataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00906 ko01100 ko01110 map00906 map01100 map01110
Pfam Domains
Protein Families
adh_short_C2

Protein Analysis

275

Amino Acids

31.15

Weight (kDa)

9.2

Isoelectric Point (pI)

47.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 261, 797
AccB7I CCANNNNNTGG 2 cut(s) 31, 775
AccI GTMKAC 2 cut(s) 183, 408
AccII CGCG 2 cut(s) 267, 579
AclWI GGATC 2 cut(s) 306, 461
AcoI YGGCCR 1 cut(s) 374
AcsI RAATTY 2 cut(s) 286, 536
AcuI CTGAAG 2 cut(s) 674, 722
AcvI CACGTG 1 cut(s) 715
AcyI GRCGYC 1 cut(s) 611
AfaI GTAC 1 cut(s) 437
AfiI CCNNNNNNNGG 6 cut(s) 20, 31, 135, 280, 419, 775
AflIII ACRYGT 1 cut(s) 712
AgeI ACCGGT 1 cut(s) 64
AgsI TTSAA 2 cut(s) 166, 361
AjnI CCWGG 1 cut(s) 24
AjuI GAANNNNNNNTTGG 4 cut(s) 278, 310, 522, 554
AluBI AGCT 4 cut(s) 559, 566, 637, 652
AluI AGCT 4 cut(s) 559, 566, 637, 652
Alw26I GTCTC 3 cut(s) 297, 347, 620
AlwI GGATC 2 cut(s) 306, 461
AoxI GGCC 4 cut(s) 22, 187, 374, 695
ApeKI GCWGC 2 cut(s) 79, 99
ApoI RAATTY 2 cut(s) 286, 536
ArsI GACNNNNNNTTYG 4 cut(s) 228, 260, 740, 772
AsiGI ACCGGT 1 cut(s) 64
Asp700I GAANNNNTTC 1 cut(s) 344
AspLEI GCGC 2 cut(s) 6, 579
AspS9I GGNCC 3 cut(s) 38, 271, 695
AsuC2I CCSGG 1 cut(s) 597
AsuHPI GGTGA 4 cut(s) 54, 79, 358, 754
AsuII TTCGAA 1 cut(s) 234
AvaII GGWCC 2 cut(s) 38, 271
BanI GGYRCC 2 cut(s) 261, 797
BauI CACGAG 1 cut(s) 567
BbrPI CACGTG 1 cut(s) 715
BbvI GCAGC 2 cut(s) 86, 91
BccI CCATC 7 cut(s) 29, 49, 233, 248, 413, 686, 779
BceAI ACGGC 4 cut(s) 138, 202, 361, 536
BcgI CGANNNNNNTGC 2 cut(s) 281, 315
BciT130I CCWGG 1 cut(s) 26
BciVI GTATCC 1 cut(s) 206
BcnI CCSGG 1 cut(s) 597
BcoDI GTCTC 3 cut(s) 297, 347, 620
BfaI CTAG 1 cut(s) 114
BfmI CTRYAG 1 cut(s) 46
BfuI GTATCC 1 cut(s) 206
BisI GCNGC 8 cut(s) 7, 80, 100, 151, 160, 265, 614, 698
BlsI GCNGC 8 cut(s) 8, 81, 101, 152, 161, 266, 615, 699
Bme1390I CCNGG 2 cut(s) 26, 597
Bme18I GGWCC 2 cut(s) 38, 271
BmgT120I GGNCC 3 cut(s) 38, 271, 695
BmiI GGNNCC 2 cut(s) 263, 799
BmrFI CCNGG 2 cut(s) 26, 597
BmsI GCATC 1 cut(s) 712
BpmI CTGGAG 1 cut(s) 108
Bpu14I TTCGAA 1 cut(s) 234
BpuMI CCSGG 1 cut(s) 597
BsaAI YACGTR 1 cut(s) 715
BsaHI GRCGYC 1 cut(s) 611
BsaJI CCNNGG 1 cut(s) 25
BsaWI WCCGGW 1 cut(s) 64
Bsc4I CCNNNNNNNGG 6 cut(s) 20, 31, 135, 280, 419, 775
Bse118I RCCGGY 1 cut(s) 64
Bse1I ACTGG 1 cut(s) 41
BseBI CCWGG 1 cut(s) 26
BseDI CCNNGG 1 cut(s) 25
BseGI GGATG 4 cut(s) 40, 60, 225, 727
BseLI CCNNNNNNNGG 6 cut(s) 20, 31, 135, 280, 419, 775
BseMII CTCAG 3 cut(s) 205, 312, 461
BseNI ACTGG 1 cut(s) 41
BseXI GCAGC 2 cut(s) 86, 91
Bsh1236I CGCG 2 cut(s) 267, 579
BshFI GGCC 4 cut(s) 24, 189, 376, 697
BshNI GGYRCC 2 cut(s) 261, 797
BshTI ACCGGT 1 cut(s) 64
BsiSI CCGG 2 cut(s) 65, 596
BslFI GGGAC 1 cut(s) 622
BslI CCNNNNNNNGG 6 cut(s) 20, 31, 135, 280, 419, 775
BsmAI GTCTC 3 cut(s) 297, 347, 620
BsmBI CGTCTC 1 cut(s) 347
BsmFI GGGAC 1 cut(s) 622
BsnI GGCC 4 cut(s) 24, 189, 376, 697
Bsp119I TTCGAA 1 cut(s) 234
Bsp143I GATC 2 cut(s) 298, 453
BspANI GGCC 4 cut(s) 24, 189, 376, 697
BspCNI CTCAG 3 cut(s) 204, 313, 460
BspFNI CGCG 2 cut(s) 267, 579
BspLI GGNNCC 2 cut(s) 263, 799
BspPI GGATC 2 cut(s) 306, 461
BspT104I TTCGAA 1 cut(s) 234
BspT107I GGYRCC 2 cut(s) 261, 797
BsrFI RCCGGY 1 cut(s) 64
BsrI ACTGG 1 cut(s) 41
BssAI RCCGGY 1 cut(s) 64
BssECI CCNNGG 1 cut(s) 25
BssMI GATC 2 cut(s) 298, 453
BssNI GRCGYC 1 cut(s) 611
BssSI CACGAG 1 cut(s) 567
Bst2BI CACGAG 1 cut(s) 567
Bst2UI CCWGG 1 cut(s) 26
Bst4CI ACNGT 2 cut(s) 111, 212
BstACI GRCGYC 1 cut(s) 611
BstBAI YACGTR 1 cut(s) 715
BstBI TTCGAA 1 cut(s) 234
BstC8I GCNNGC 3 cut(s) 11, 141, 485
BstDEI CTNAG 3 cut(s) 191, 321, 447
BstF5I GGATG 4 cut(s) 40, 60, 225, 727
BstFNI CGCG 2 cut(s) 267, 579
BstHHI GCGC 2 cut(s) 6, 579
BstKTI GATC 2 cut(s) 301, 456
BstMAI GTCTC 3 cut(s) 297, 347, 620
BstMBI GATC 2 cut(s) 298, 453
BstMWI GCNNNNNNNGC 8 cut(s) 10, 156, 159, 168, 177, 186, 273, 585
BstNI CCWGG 1 cut(s) 26
BstSCI CCNGG 2 cut(s) 24, 595
BstSFI CTRYAG 1 cut(s) 46
BstUI CGCG 2 cut(s) 267, 579
BstV1I GCAGC 2 cut(s) 86, 91
BstX2I RGATCY 1 cut(s) 453
BstYI RGATCY 1 cut(s) 453
BsuI GTATCC 1 cut(s) 206
BsuRI GGCC 4 cut(s) 24, 189, 376, 697
BtsCI GGATG 4 cut(s) 40, 60, 225, 727
BtsIMutI CAGTG 1 cut(s) 455
Cac8I GCNNGC 3 cut(s) 11, 141, 485
CfoI GCGC 2 cut(s) 6, 579
Cfr10I RCCGGY 1 cut(s) 64
Cfr13I GGNCC 3 cut(s) 38, 271, 695
CseI GACGC 2 cut(s) 169, 619
Csp6I GTAC 1 cut(s) 436
CspAI ACCGGT 1 cut(s) 64
CspCI CAANNNNNGTGG 2 cut(s) 317, 352
CviAII CATG 3 cut(s) 332, 349, 548
CviQI GTAC 1 cut(s) 436
DdeI CTNAG 3 cut(s) 191, 321, 447
DpnI GATC 2 cut(s) 300, 455
DpnII GATC 2 cut(s) 298, 453
EaeI YGGCCR 1 cut(s) 374
EciI GGCGGA 1 cut(s) 734
Eco47I GGWCC 2 cut(s) 38, 271
Eco57I CTGAAG 2 cut(s) 674, 722
Eco72I CACGTG 1 cut(s) 715
EcoRII CCWGG 1 cut(s) 24
Esp3I CGTCTC 1 cut(s) 347
FaeI CATG 3 cut(s) 335, 352, 551
FaqI GGGAC 1 cut(s) 622
FatI CATG 3 cut(s) 331, 348, 547
FblI GTMKAC 2 cut(s) 183, 408
Fnu4HI GCNGC 8 cut(s) 7, 80, 100, 151, 160, 265, 614, 698
FokI GGATG 4 cut(s) 47, 67, 212, 734
Fsp4HI GCNGC 8 cut(s) 7, 80, 100, 151, 160, 265, 614, 698
FspBI CTAG 1 cut(s) 114
GlaI GCGC 2 cut(s) 5, 578
GluI GCNGC 8 cut(s) 7, 80, 100, 151, 160, 265, 614, 698
GsuI CTGGAG 1 cut(s) 108
HaeIII GGCC 4 cut(s) 24, 189, 376, 697
HapII CCGG 2 cut(s) 65, 596
HgaI GACGC 2 cut(s) 169, 619
HhaI GCGC 2 cut(s) 6, 579
Hin1I GRCGYC 1 cut(s) 611
Hin1II CATG 3 cut(s) 335, 352, 551
Hin6I GCGC 2 cut(s) 4, 577
HinP1I GCGC 2 cut(s) 4, 577
HincII GTYRAC 3 cut(s) 184, 409, 444
HindII GTYRAC 3 cut(s) 184, 409, 444
HindIII AAGCTT 1 cut(s) 635
HinfI GANTC 2 cut(s) 59, 305
HpaI GTTAAC 1 cut(s) 444
HpaII CCGG 2 cut(s) 65, 596
HphI GGTGA 4 cut(s) 54, 79, 358, 754
Hpy166II GTNNAC 4 cut(s) 184, 409, 444, 583
Hpy188I TCNGA 3 cut(s) 543, 682, 745
Hpy188III TCNNGA 1 cut(s) 302
Hpy8I GTNNAC 4 cut(s) 184, 409, 444, 583
Hpy99I CGWCG 6 cut(s) 137, 159, 185, 188, 248, 419
HpyAV CCTTC 3 cut(s) 334, 649, 697
HpyCH4III ACNGT 2 cut(s) 111, 212
HpyCH4IV ACGT 2 cut(s) 356, 714
HpyCH4V TGCA 2 cut(s) 79, 292
HpyF10VI GCNNNNNNNGC 8 cut(s) 10, 156, 159, 168, 177, 186, 273, 585
HpyF3I CTNAG 3 cut(s) 191, 321, 447
HpySE526I ACGT 2 cut(s) 356, 714
Hsp92I GRCGYC 1 cut(s) 611
Hsp92II CATG 3 cut(s) 335, 352, 551
HspAI GCGC 2 cut(s) 4, 577
KspAI GTTAAC 1 cut(s) 444
Kzo9I GATC 2 cut(s) 298, 453
Lsp1109I GCAGC 2 cut(s) 86, 91
LweI GCATC 1 cut(s) 712
MaeI CTAG 1 cut(s) 114
MaeII ACGT 2 cut(s) 356, 714
MaeIII GTNAC 4 cut(s) 60, 67, 364, 760
MalI GATC 2 cut(s) 300, 455
MboI GATC 2 cut(s) 298, 453
MflI RGATCY 1 cut(s) 453
MluCI AATT 3 cut(s) 286, 536, 772
MlyI GAGTC 2 cut(s) 68, 299
MmeI TCCRAC 4 cut(s) 12, 32, 352, 723
MnlI CCTC 8 cut(s) 14, 66, 132, 139, 200, 262, 637, 739
MroXI GAANNNNTTC 1 cut(s) 344
MseI TTAA 2 cut(s) 443, 633
MspA1I CMGCKG 5 cut(s) 82, 320, 616, 671, 700
MspI CCGG 2 cut(s) 65, 596
MspR9I CCNGG 2 cut(s) 26, 597
MvaI CCWGG 1 cut(s) 26
MvnI CGCG 2 cut(s) 267, 579
MwoI GCNNNNNNNGC 8 cut(s) 10, 156, 159, 168, 177, 186, 273, 585
NciI CCSGG 1 cut(s) 597
NdeII GATC 2 cut(s) 298, 453
NlaIII CATG 3 cut(s) 335, 352, 551
NlaIV GGNNCC 2 cut(s) 263, 799
NmuCI GTSAC 4 cut(s) 60, 67, 364, 760
NspV TTCGAA 1 cut(s) 234
PcsI WCGNNNNNNNCGW 2 cut(s) 240, 414
PdmI GAANNNNTTC 1 cut(s) 344
PflFI GACNNNGTC 1 cut(s) 413
PflMI CCANNNNNTGG 2 cut(s) 31, 775
PinAI ACCGGT 1 cut(s) 64
PkrI GCNGC 8 cut(s) 8, 81, 101, 152, 161, 266, 615, 699
PleI GAGTC 2 cut(s) 67, 299
PmaCI CACGTG 1 cut(s) 715
PmlI CACGTG 1 cut(s) 715
PpsI GAGTC 2 cut(s) 67, 299
Ppu21I YACGTR 1 cut(s) 715
Psp6I CCWGG 1 cut(s) 24
PspCI CACGTG 1 cut(s) 715
PspGI CCWGG 1 cut(s) 24
PspN4I GGNNCC 2 cut(s) 263, 799
PspPI GGNCC 3 cut(s) 38, 271, 695
PsuI RGATCY 1 cut(s) 453
PsyI GACNNNGTC 1 cut(s) 413
RsaI GTAC 1 cut(s) 437
RsaNI GTAC 1 cut(s) 436
SalI GTCGAC 2 cut(s) 182, 407
SaqAI TTAA 2 cut(s) 443, 633
SatI GCNGC 8 cut(s) 7, 80, 100, 151, 160, 265, 614, 698
Sau3AI GATC 2 cut(s) 298, 453
Sau96I GGNCC 3 cut(s) 38, 271, 695
SchI GAGTC 2 cut(s) 68, 299
ScrFI CCNGG 2 cut(s) 26, 597
SfaNI GCATC 1 cut(s) 712
SfcI CTRYAG 1 cut(s) 46
SfuI TTCGAA 1 cut(s) 234
SgrAI CRCCGGYG 1 cut(s) 64
SgrDI CGTCGACG 1 cut(s) 182
SinI GGWCC 2 cut(s) 38, 271
Sse9I AATT 3 cut(s) 286, 536, 772
SspMI CTAG 1 cut(s) 114
StyD4I CCNGG 2 cut(s) 24, 595
TaaI ACNGT 2 cut(s) 111, 212
TaiI ACGT 2 cut(s) 359, 717
TaqI TCGA 5 cut(s) 183, 234, 301, 408, 417
TasI AATT 3 cut(s) 286, 536, 772
TauI GCSGC 6 cut(s) 9, 153, 162, 267, 616, 700
Tru1I TTAA 2 cut(s) 443, 633
Tru9I TTAA 2 cut(s) 443, 633
TscAI CASTG 1 cut(s) 455
TseFI GTSAC 4 cut(s) 60, 67, 364, 760
TseI GCWGC 2 cut(s) 79, 99
Tsp45I GTSAC 4 cut(s) 60, 67, 364, 760
TspDTI ATGAA 1 cut(s) 337
TspGWI ACGGA 1 cut(s) 121
TspRI CASTG 1 cut(s) 455
Tth111I GACNNNGTC 1 cut(s) 413
Van91I CCANNNNNTGG 2 cut(s) 31, 775
VpaK11BI GGWCC 2 cut(s) 38, 271
XapI RAATTY 2 cut(s) 286, 536
XcmI CCANNNNNNNNNTGG 4 cut(s) 32, 48, 376, 772
XmiI GTMKAC 2 cut(s) 183, 408
XmnI GAANNNNTTC 1 cut(s) 344
XspI CTAG 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.