Rmu_sc0001599.1_g000013

Domain of unknown function (DUF313)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001599.1
OG0016388
Physical Location & Seq
Forward (+)
69826 .. 70686
861 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 861 bp
atgaacctgaagattgtcatcaagaatgtcaagaaggcagccaccgtggtcaacgggtcgacgatcaagaagaacaatgtcgtgccctcatcaattccggaatcaaaacatagtttagacttgtcccaaatcatgaccatgcccaaaaatcaagtaaacttgatactgccgaagttaccaccaaagaaacgatggtttgtggtatatcgacgaatgttaacaaagaccaagcctgcagctacaaaaatcaccacggacattcctttttctaaaaggaaatacgattctgaagatcattataatcaggatgataaagctagggttcccaagtttaaacgttcgcagaagggcgtacctcccagtacaaatactggtcctgagttgcctgaagattacaagcaaatcattctcggcagattgaaggggaagcaattgactttgttgatagagaagagtttgaatgctagggatgtgaagtgtgacaagagcatattgaccttgccatcatatgaaaccctatctaagaatttcttggaacctaatgagattggaaaccttgagaggcataaaaccctaaagcttccattgatagacccgaaatgcttggagtggtggaagatgtcgaaagaggaactttatgtgccgaaaaccaactggaatgagattgtggagcagaatcgtatcgttataggagataaagttcaagtttggtcattccgggctaataaggatgggaccgaggatcagcttcacttggctcttgttttggttaagagaggtgaaaatcaaattggtgatggtaaaaagagtggccaagaaaatgacagtaatagtgaaggaagtactgtgagcaatctgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF313

Protein Analysis

286

Amino Acids

32.58

Weight (kDa)

9.68

Isoelectric Point (pI)

47.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016388)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g13010
malus_domestica MD01G1052000.v1.1
prunus_persica Prupe.2G154200_v2.0.a1
rosa_laevigata RLG00000008091 RLG00000028355
rosa_multiflora Rmu_sc0001599.1_g000013
rosa_roxburghii Rroxscaffold_5G00358980
rosa_rugosa Rorug01G0225200 Rorug04G0132500
rosa_samantha Rh1AG239400 Rh1BG210200 Rh1DG236900 Rh4AG192600 Rh4DG190500
rosa_wichuraiana Rw1G020780

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 300
AccI GTMKAC 1 cut(s) 59
AccIII TCCGGA 1 cut(s) 97
AclI AACGTT 1 cut(s) 337
AclWI GGATC 1 cut(s) 750
AcoI YGGCCR 1 cut(s) 811
AcsI RAATTY 1 cut(s) 526
AcuI CTGAAG 3 cut(s) 29, 309, 408
AfaI GTAC 3 cut(s) 354, 364, 844
AgsI TTSAA 3 cut(s) 421, 460, 704
AjuI GAANNNNNNNTTGG 2 cut(s) 774, 806
AloI GAACNNNNNNTCC 2 cut(s) 684, 716
AluBI AGCT 4 cut(s) 239, 317, 580, 748
AluI AGCT 4 cut(s) 239, 317, 580, 748
AlwI GGATC 1 cut(s) 750
Aor13HI TCCGGA 1 cut(s) 97
AoxI GGCC 1 cut(s) 811
ApeKI GCWGC 2 cut(s) 38, 236
ApoI RAATTY 1 cut(s) 526
AspS9I GGNCC 2 cut(s) 374, 735
AsuC2I CCSGG 1 cut(s) 719
AsuHPI GGTGA 3 cut(s) 241, 791, 806
AvaII GGWCC 2 cut(s) 374, 735
BaeGI GKGCMC 1 cut(s) 87
BalI TGGCCA 1 cut(s) 813
BbvI GCAGC 2 cut(s) 50, 248
BccI CCATC 4 cut(s) 186, 511, 725, 791
BcnI CCSGG 1 cut(s) 719
BfaI CTAG 2 cut(s) 318, 465
BfmI CTRYAG 1 cut(s) 234
BisI GCNGC 2 cut(s) 39, 237
BlsI GCNGC 2 cut(s) 40, 238
BmcAI AGTACT 1 cut(s) 844
Bme1390I CCNGG 1 cut(s) 719
Bme18I GGWCC 2 cut(s) 374, 735
BmgT120I GGNCC 2 cut(s) 374, 735
BmiI GGNNCC 3 cut(s) 324, 537, 736
BmrFI CCNGG 1 cut(s) 719
BmrI ACTGGG 1 cut(s) 354
BmuI ACTGGG 1 cut(s) 354
BpuEI CTTGAG 1 cut(s) 578
BpuMI CCSGG 1 cut(s) 719
BsaBI GATNNNNATC 1 cut(s) 17
BsaJI CCNNGG 3 cut(s) 45, 252, 738
BsaWI WCCGGW 1 cut(s) 97
BsaXI ACNNNNNCTCC 2 cut(s) 684, 714
Bse1I ACTGG 3 cut(s) 360, 376, 659
Bse8I GATNNNNATC 1 cut(s) 17
BseAI TCCGGA 1 cut(s) 97
BseDI CCNNGG 3 cut(s) 45, 252, 738
BseGI GGATG 3 cut(s) 313, 475, 736
BseJI GATNNNNATC 1 cut(s) 17
BseMII CTCAG 1 cut(s) 369
BseNI ACTGG 3 cut(s) 360, 376, 659
BseSI GKGCMC 1 cut(s) 87
BseXI GCAGC 2 cut(s) 50, 248
BshFI GGCC 1 cut(s) 813
BsiSI CCGG 2 cut(s) 98, 718
BslFI GGGAC 2 cut(s) 109, 748
BsmFI GGGAC 2 cut(s) 109, 748
BsmI GAATGC 1 cut(s) 466
BsnI GGCC 1 cut(s) 813
Bsp1286I GDGCHC 1 cut(s) 87
Bsp13I TCCGGA 1 cut(s) 97
Bsp143I GATC 3 cut(s) 63, 292, 742
BspANI GGCC 1 cut(s) 813
BspCNI CTCAG 1 cut(s) 370
BspEI TCCGGA 1 cut(s) 97
BspHI TCATGA 1 cut(s) 132
BspLI GGNNCC 3 cut(s) 324, 537, 736
BspMAI CTGCAG 1 cut(s) 238
BspPI GGATC 1 cut(s) 750
BsrI ACTGG 3 cut(s) 360, 376, 659
BssECI CCNNGG 3 cut(s) 45, 252, 738
BssMI GATC 3 cut(s) 63, 292, 742
Bst4CI ACNGT 3 cut(s) 46, 827, 847
Bst6I CTCTTC 1 cut(s) 446
BstC8I GCNNGC 1 cut(s) 234
BstDEI CTNAG 2 cut(s) 378, 522
BstDSI CCRYGG 2 cut(s) 45, 252
BstF5I GGATG 3 cut(s) 313, 475, 736
BstKTI GATC 3 cut(s) 66, 295, 745
BstMBI GATC 3 cut(s) 63, 292, 742
BstSCI CCNGG 1 cut(s) 717
BstSFI CTRYAG 1 cut(s) 234
BstSLI GKGCMC 1 cut(s) 87
BstV1I GCAGC 2 cut(s) 50, 248
BsuRI GGCC 1 cut(s) 813
BtgI CCRYGG 2 cut(s) 45, 252
BtsCI GGATG 3 cut(s) 313, 475, 736
Cac8I GCNNGC 1 cut(s) 234
CciI TCATGA 1 cut(s) 132
Cfr13I GGNCC 2 cut(s) 374, 735
Csp6I GTAC 3 cut(s) 353, 363, 843
CviAII CATG 2 cut(s) 133, 139
CviJI RGCY 9 cut(s) 41, 232, 239, 317, 580, 722, 748, 758, 813
CviKI_1 RGCY 9 cut(s) 41, 232, 239, 317, 580, 722, 748, 758, 813
CviQI GTAC 3 cut(s) 353, 363, 843
DdeI CTNAG 2 cut(s) 378, 522
DpnI GATC 3 cut(s) 65, 294, 744
DpnII GATC 3 cut(s) 63, 292, 742
DraI TTTAAA 1 cut(s) 334
EaeI YGGCCR 1 cut(s) 811
Eam1104I CTCTTC 1 cut(s) 446
EarI CTCTTC 1 cut(s) 446
Eco47I GGWCC 2 cut(s) 374, 735
Eco57I CTGAAG 3 cut(s) 29, 309, 408
FaeI CATG 2 cut(s) 136, 142
FalI AAGNNNNNCTT 4 cut(s) 515, 547, 618, 650
FaqI GGGAC 2 cut(s) 109, 748
FatI CATG 2 cut(s) 132, 138
FauNDI CATATG 1 cut(s) 508
FblI GTMKAC 1 cut(s) 59
Fnu4HI GCNGC 2 cut(s) 39, 237
FokI GGATG 3 cut(s) 320, 482, 743
Fsp4HI GCNGC 2 cut(s) 39, 237
FspBI CTAG 2 cut(s) 318, 465
GluI GCNGC 2 cut(s) 39, 237
HaeIII GGCC 1 cut(s) 813
HapII CCGG 2 cut(s) 98, 718
Hin1II CATG 2 cut(s) 136, 142
HincII GTYRAC 3 cut(s) 52, 60, 219
HindII GTYRAC 3 cut(s) 52, 60, 219
HindIII AAGCTT 1 cut(s) 578
HinfI GANTC 3 cut(s) 101, 284, 676
HpaI GTTAAC 1 cut(s) 219
HpaII CCGG 2 cut(s) 98, 718
HphI GGTGA 3 cut(s) 241, 791, 806
Hpy166II GTNNAC 4 cut(s) 52, 60, 157, 219
Hpy188I TCNGA 1 cut(s) 289
Hpy188III TCNNGA 7 cut(s) 22, 31, 67, 98, 133, 305, 377
Hpy8I GTNNAC 4 cut(s) 52, 60, 157, 219
Hpy99I CGWCG 2 cut(s) 64, 213
HpyAV CCTTC 4 cut(s) 28, 340, 415, 830
HpyCH4III ACNGT 3 cut(s) 46, 827, 847
HpyCH4IV ACGT 1 cut(s) 337
HpyCH4V TGCA 1 cut(s) 236
HpyF3I CTNAG 2 cut(s) 378, 522
HpySE526I ACGT 1 cut(s) 337
Hsp92II CATG 2 cut(s) 136, 142
Kpn2I TCCGGA 1 cut(s) 97
KspAI GTTAAC 1 cut(s) 219
Kzo9I GATC 3 cut(s) 63, 292, 742
LmnI GCTCC 1 cut(s) 670
Lsp1109I GCAGC 2 cut(s) 50, 248
MaeI CTAG 2 cut(s) 318, 465
MaeII ACGT 1 cut(s) 337
MaeIII GTNAC 2 cut(s) 174, 479
MalI GATC 3 cut(s) 65, 294, 744
MboI GATC 3 cut(s) 63, 292, 742
MboII GAAGA 6 cut(s) 22, 82, 302, 401, 463, 628
MfeI CAATTG 1 cut(s) 431
MhlI GDGCHC 1 cut(s) 87
MlsI TGGCCA 1 cut(s) 813
MluCI AATT 4 cut(s) 93, 431, 526, 789
MluNI TGGCCA 1 cut(s) 813
MnlI CCTC 6 cut(s) 97, 366, 555, 622, 733, 770
Mox20I TGGCCA 1 cut(s) 813
MroI TCCGGA 1 cut(s) 97
MscI TGGCCA 1 cut(s) 813
MseI TTAA 3 cut(s) 218, 333, 771
MslI CAYNNNNRTG 1 cut(s) 137
Msp20I TGGCCA 1 cut(s) 813
MspI CCGG 2 cut(s) 98, 718
MspR9I CCNGG 1 cut(s) 719
MssI GTTTAAAC 1 cut(s) 334
MunI CAATTG 1 cut(s) 431
Mva1269I GAATGC 1 cut(s) 466
NciI CCSGG 1 cut(s) 719
NdeI CATATG 1 cut(s) 508
NdeII GATC 3 cut(s) 63, 292, 742
NlaIII CATG 2 cut(s) 136, 142
NlaIV GGNNCC 3 cut(s) 324, 537, 736
NmeAIII GCCGAG 1 cut(s) 390
NmuCI GTSAC 1 cut(s) 479
PagI TCATGA 1 cut(s) 132
PctI GAATGC 1 cut(s) 466
PfeI GAWTC 3 cut(s) 101, 284, 676
PkrI GCNGC 2 cut(s) 40, 238
PmeI GTTTAAAC 1 cut(s) 334
PsiI TTATAA 1 cut(s) 300
Psp1406I AACGTT 1 cut(s) 337
PspN4I GGNNCC 3 cut(s) 324, 537, 736
PspPI GGNCC 2 cut(s) 374, 735
PstI CTGCAG 1 cut(s) 238
RsaI GTAC 3 cut(s) 354, 364, 844
RsaNI GTAC 3 cut(s) 353, 363, 843
RseI CAYNNNNRTG 1 cut(s) 137
SalI GTCGAC 1 cut(s) 58
SaqAI TTAA 3 cut(s) 218, 333, 771
SatI GCNGC 2 cut(s) 39, 237
Sau3AI GATC 3 cut(s) 63, 292, 742
Sau96I GGNCC 2 cut(s) 374, 735
ScaI AGTACT 1 cut(s) 844
ScrFI CCNGG 1 cut(s) 719
SduI GDGCHC 1 cut(s) 87
SfcI CTRYAG 1 cut(s) 234
SinI GGWCC 2 cut(s) 374, 735
SmiMI CAYNNNNRTG 1 cut(s) 137
SmlI CTYRAG 1 cut(s) 557
SmoI CTYRAG 1 cut(s) 557
Sse9I AATT 4 cut(s) 93, 431, 526, 789
SspMI CTAG 2 cut(s) 318, 465
StyD4I CCNGG 1 cut(s) 717
TaaI ACNGT 3 cut(s) 46, 827, 847
TaiI ACGT 1 cut(s) 340
TaqI TCGA 3 cut(s) 59, 208, 623
TaqII GACCGA 1 cut(s) 752
TasI AATT 4 cut(s) 93, 431, 526, 789
TatI WGTACW 2 cut(s) 362, 842
TfiI GAWTC 3 cut(s) 101, 284, 676
Tru1I TTAA 3 cut(s) 218, 333, 771
Tru9I TTAA 3 cut(s) 218, 333, 771
TseFI GTSAC 1 cut(s) 479
TseI GCWGC 2 cut(s) 38, 236
Tsp45I GTSAC 1 cut(s) 479
TspDTI ATGAA 2 cut(s) 17, 525
TspGWI ACGGA 1 cut(s) 269
VpaK11BI GGWCC 2 cut(s) 374, 735
XapI RAATTY 1 cut(s) 526
XcmI CCANNNNNNNNNTGG 1 cut(s) 189
XmiI GTMKAC 1 cut(s) 59
XspI CTAG 2 cut(s) 318, 465
ZrmI AGTACT 1 cut(s) 844
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.