Rorug01G0225200

Domain of unknown function (DUF313)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0016388
Physical Location & Seq
Reverse (-)
32371025 .. 32371249
225 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0225200.1

Sequence Viewer

Length: 225 bp
ATGGGTATGATGAAGAAGTTGAGTGAATTGAACACTCTCTGTGGAATTGATGCATGTGCTATTGTTTATAGCTCATTTGATTCTCAACCCAAGGTTTGGCCTTCTCCTTCTAGTGTTGAAAAAGTTTTAAAACAGTTCAAGAATATGCCTATGACTGAGAAGAGTACGAAGATGTTGAGCCAAGAAAGCTATATGAGGGGGATGATCTCTAAAGCAGATAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF313

Protein Analysis

74

Amino Acids

8.31

Weight (kDa)

9.0

Isoelectric Point (pI)

56.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SRF-TF PF00319 2 - 25 1.2e-07 SRF-type transcription factor (DNA-binding and dimerisation domain)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016388)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g13010
malus_domestica MD01G1052000.v1.1
prunus_persica Prupe.2G154200_v2.0.a1
rosa_laevigata RLG00000008091 RLG00000028355
rosa_multiflora Rmu_sc0001599.1_g000013
rosa_roxburghii Rroxscaffold_5G00358980
rosa_rugosa Rorug01G0225200 Rorug04G0132500
rosa_samantha Rh1AG239400 Rh1BG210200 Rh1DG236900 Rh4AG192600 Rh4DG190500
rosa_wichuraiana Rw1G020780

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 96
AfaI GTAC 1 cut(s) 166
AfiI CCNNNNNNNGG 1 cut(s) 96
AgsI TTSAA 3 cut(s) 31, 119, 139
AluBI AGCT 2 cut(s) 72, 189
AluI AGCT 2 cut(s) 72, 189
AoxI GGCC 1 cut(s) 98
BfaI CTAG 1 cut(s) 111
BmsI GCATC 1 cut(s) 40
BsaJI CCNNGG 1 cut(s) 90
Bsc4I CCNNNNNNNGG 1 cut(s) 96
BseDI CCNNGG 1 cut(s) 90
BseGI GGATG 1 cut(s) 207
BseLI CCNNNNNNNGG 1 cut(s) 96
BseMII CTCAG 1 cut(s) 147
BshFI GGCC 1 cut(s) 100
BslI CCNNNNNNNGG 1 cut(s) 96
BsnI GGCC 1 cut(s) 100
Bsp143I GATC 1 cut(s) 204
BspANI GGCC 1 cut(s) 100
BspCNI CTCAG 1 cut(s) 148
BssECI CCNNGG 1 cut(s) 90
BssMI GATC 1 cut(s) 204
BssT1I CCWWGG 1 cut(s) 90
Bst4CI ACNGT 1 cut(s) 135
Bst6I CTCTTC 1 cut(s) 155
BstDEI CTNAG 1 cut(s) 156
BstF5I GGATG 1 cut(s) 207
BstKTI GATC 1 cut(s) 207
BstMBI GATC 1 cut(s) 204
BstMWI GCNNNNNNNGC 1 cut(s) 186
BstNSI RCATGY 1 cut(s) 57
BsuRI GGCC 1 cut(s) 100
BtsCI GGATG 1 cut(s) 207
Csp6I GTAC 1 cut(s) 165
CviAII CATG 1 cut(s) 54
CviJI RGCY 4 cut(s) 72, 100, 180, 189
CviKI_1 RGCY 4 cut(s) 72, 100, 180, 189
CviQI GTAC 1 cut(s) 165
DdeI CTNAG 1 cut(s) 156
DpnI GATC 1 cut(s) 206
DpnII GATC 1 cut(s) 204
DraI TTTAAA 1 cut(s) 129
Eam1104I CTCTTC 1 cut(s) 155
EarI CTCTTC 1 cut(s) 155
Eco130I CCWWGG 1 cut(s) 90
EcoT14I CCWWGG 1 cut(s) 90
EcoT22I ATGCAT 1 cut(s) 55
ErhI CCWWGG 1 cut(s) 90
FaeI CATG 1 cut(s) 57
FaiI YATR 7 cut(s) 8, 55, 69, 146, 152, 192, 194
FatI CATG 1 cut(s) 53
FokI GGATG 1 cut(s) 214
FspBI CTAG 1 cut(s) 111
HaeIII GGCC 1 cut(s) 100
Hin1II CATG 1 cut(s) 57
HinfI GANTC 1 cut(s) 80
Hpy188III TCNNGA 1 cut(s) 139
HpyAV CCTTC 2 cut(s) 111, 117
HpyCH4III ACNGT 1 cut(s) 135
HpyCH4V TGCA 1 cut(s) 53
HpyF10VI GCNNNNNNNGC 1 cut(s) 186
HpyF3I CTNAG 1 cut(s) 156
Hsp92II CATG 1 cut(s) 57
Kzo9I GATC 1 cut(s) 204
LweI GCATC 1 cut(s) 40
MaeI CTAG 1 cut(s) 111
MalI GATC 1 cut(s) 206
MboI GATC 1 cut(s) 204
MboII GAAGA 3 cut(s) 25, 172, 181
MluCI AATT 3 cut(s) 26, 45, 220
MnlI CCTC 1 cut(s) 189
Mph1103I ATGCAT 1 cut(s) 55
MseI TTAA 2 cut(s) 128, 223
MwoI GCNNNNNNNGC 1 cut(s) 186
NdeII GATC 1 cut(s) 204
NlaIII CATG 1 cut(s) 57
NsiI ATGCAT 1 cut(s) 55
NspI RCATGY 1 cut(s) 57
PfeI GAWTC 1 cut(s) 80
PflMI CCANNNNNTGG 1 cut(s) 96
RsaI GTAC 1 cut(s) 166
RsaNI GTAC 1 cut(s) 165
SaqAI TTAA 2 cut(s) 128, 223
Sau3AI GATC 1 cut(s) 204
SetI ASST 3 cut(s) 74, 96, 191
SfaNI GCATC 1 cut(s) 40
SgeI CNNG 5 cut(s) 66, 103, 123, 151, 194
Sse9I AATT 3 cut(s) 26, 45, 220
SspMI CTAG 1 cut(s) 111
StyI CCWWGG 1 cut(s) 90
TaaI ACNGT 1 cut(s) 135
TasI AATT 3 cut(s) 26, 45, 220
TfiI GAWTC 1 cut(s) 80
Tru1I TTAA 2 cut(s) 128, 223
Tru9I TTAA 2 cut(s) 128, 223
TspDTI ATGAA 1 cut(s) 26
Van91I CCANNNNNTGG 1 cut(s) 96
XceI RCATGY 1 cut(s) 57
XspI CTAG 1 cut(s) 111
Zsp2I ATGCAT 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.