Rmu_sc0001716.1_g000034

Domain of unknown function (DUF2828)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001716.1
OG0017845
Physical Location & Seq
Forward (+)
138484 .. 138813
330 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 330 bp
atgcaagcattggtgagggggctaaaacttcctaatcaaatagtagcttacttgatgaacaagcaaataagtgacgaaactgcagatctagaatgggagaaactagtacgagggttgtcaaacaaaggcatgtttaaggattgtgttgttgtgtgtgacatgccgagcatgaaagggacaaagacggagatggcttgcatttcaatggggttactgatttcagaactgagtgcaaatccgtggaaaggaaaagtattctcctcggcaggaaggatgttcaagatgccaatgttgaaggagacagtctcagatcaaaatgtgagtttatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF2828

Protein Analysis

109

Amino Acids

12.12

Weight (kDa)

8.84

Isoelectric Point (pI)

24.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7788 PF25043 47 - 94 5.2e-06 Domain of unknown function (DUF7788)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 108
AfiI CCNNNNNNNGG 1 cut(s) 245
AgsI TTSAA 3 cut(s) 204, 280, 295
AhlI ACTAGT 1 cut(s) 103
AluBI AGCT 1 cut(s) 47
AluI AGCT 1 cut(s) 47
Alw26I GTCTC 2 cut(s) 293, 310
AsuHPI GGTGA 1 cut(s) 25
BccI CCATC 1 cut(s) 184
BcoDI GTCTC 2 cut(s) 293, 310
BcuI ACTAGT 1 cut(s) 103
BfaI CTAG 2 cut(s) 89, 104
BfmI CTRYAG 1 cut(s) 81
BglII AGATCT 1 cut(s) 85
BmsI GCATC 1 cut(s) 273
BplI GAGNNNNNCTC 2 cut(s) 290, 322
BsaJI CCNNGG 2 cut(s) 239, 261
Bsc4I CCNNNNNNNGG 1 cut(s) 245
BseDI CCNNGG 2 cut(s) 239, 261
BseGI GGATG 1 cut(s) 279
BseLI CCNNNNNNNGG 1 cut(s) 245
BseMII CTCAG 2 cut(s) 218, 321
BseRI GAGGAG 1 cut(s) 250
BslFI GGGAC 1 cut(s) 190
BslI CCNNNNNNNGG 1 cut(s) 245
BsmAI GTCTC 2 cut(s) 293, 310
BsmFI GGGAC 1 cut(s) 190
Bsp143I GATC 2 cut(s) 85, 310
BspCNI CTCAG 2 cut(s) 219, 320
BspMAI CTGCAG 1 cut(s) 85
BssECI CCNNGG 2 cut(s) 239, 261
BssMI GATC 2 cut(s) 85, 310
Bst4CI ACNGT 1 cut(s) 304
BstC8I GCNNGC 2 cut(s) 6, 196
BstDEI CTNAG 2 cut(s) 227, 307
BstDSI CCRYGG 1 cut(s) 239
BstF5I GGATG 1 cut(s) 279
BstKTI GATC 2 cut(s) 88, 313
BstMAI GTCTC 2 cut(s) 293, 310
BstMBI GATC 2 cut(s) 85, 310
BstNSI RCATGY 2 cut(s) 133, 163
BstSFI CTRYAG 1 cut(s) 81
BstX2I RGATCY 1 cut(s) 85
BstYI RGATCY 1 cut(s) 85
BtgI CCRYGG 1 cut(s) 239
BtsCI GGATG 1 cut(s) 279
Cac8I GCNNGC 2 cut(s) 6, 196
Csp6I GTAC 1 cut(s) 107
CviAII CATG 3 cut(s) 130, 160, 169
CviJI RGCY 3 cut(s) 22, 47, 194
CviKI_1 RGCY 3 cut(s) 22, 47, 194
CviQI GTAC 1 cut(s) 107
DdeI CTNAG 2 cut(s) 227, 307
DpnI GATC 2 cut(s) 87, 312
DpnII GATC 2 cut(s) 85, 310
FaeI CATG 3 cut(s) 133, 163, 172
FaiI YATR 4 cut(s) 131, 161, 170, 328
FaqI GGGAC 1 cut(s) 190
FatI CATG 3 cut(s) 129, 159, 168
FokI GGATG 1 cut(s) 286
FspBI CTAG 2 cut(s) 89, 104
Hin1II CATG 3 cut(s) 133, 163, 172
HphI GGTGA 1 cut(s) 25
Hpy188I TCNGA 2 cut(s) 223, 310
Hpy188III TCNNGA 2 cut(s) 89, 280
HpyAV CCTTC 2 cut(s) 264, 289
HpyCH4III ACNGT 1 cut(s) 304
HpyCH4V TGCA 4 cut(s) 4, 83, 198, 233
HpyF3I CTNAG 2 cut(s) 227, 307
Hsp92II CATG 3 cut(s) 133, 163, 172
Kzo9I GATC 2 cut(s) 85, 310
LpnPI CCDG 1 cut(s) 252
LweI GCATC 1 cut(s) 273
MaeI CTAG 2 cut(s) 89, 104
MaeIII GTNAC 3 cut(s) 71, 155, 210
MalI GATC 2 cut(s) 87, 312
MboI GATC 2 cut(s) 85, 310
MflI RGATCY 1 cut(s) 85
MnlI CCTC 3 cut(s) 9, 104, 271
MseI TTAA 1 cut(s) 135
MslI CAYNNNNRTG 1 cut(s) 203
NdeII GATC 2 cut(s) 85, 310
NlaIII CATG 3 cut(s) 133, 163, 172
NmeAIII GCCGAG 2 cut(s) 189, 242
NmuCI GTSAC 2 cut(s) 71, 155
NspI RCATGY 2 cut(s) 133, 163
PstI CTGCAG 1 cut(s) 85
PsuI RGATCY 1 cut(s) 85
RsaI GTAC 1 cut(s) 108
RsaNI GTAC 1 cut(s) 107
RseI CAYNNNNRTG 1 cut(s) 203
SaqAI TTAA 1 cut(s) 135
Sau3AI GATC 2 cut(s) 85, 310
SetI ASST 1 cut(s) 49
SfaNI GCATC 1 cut(s) 273
SfcI CTRYAG 1 cut(s) 81
SmiMI CAYNNNNRTG 1 cut(s) 203
SpeI ACTAGT 1 cut(s) 103
SspMI CTAG 2 cut(s) 89, 104
TaaI ACNGT 1 cut(s) 304
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TseFI GTSAC 2 cut(s) 71, 155
Tsp45I GTSAC 2 cut(s) 71, 155
TspDTI ATGAA 2 cut(s) 71, 185
TspGWI ACGGA 2 cut(s) 200, 228
XbaI TCTAGA 1 cut(s) 88
XceI RCATGY 2 cut(s) 133, 163
XspI CTAG 2 cut(s) 89, 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.