Rmu_sc0001981.1_g000055

phosphatase 2C

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001981.1
OG0019302
Physical Location & Seq
Forward (+)
185022 .. 186519
1498 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001981.1_g000055.1.cds

Sequence Viewer

Length: 648 bp
atggtggaagtcgtcggagctgaagaagccgatgtcatggtcatggtggaagtactgctcgacgggaaccggaataggaacgtaatcgtagacttgggcgttagatcgaattttaagatgactactttgttgatgtgttttctcaggtctttgctcgtggcaaatgctggagattgcagggctatattgtcacgaaatggagcagctatagaaatgtcaaaagatcatagaccctgctgcaaaaaagaaaggacacgaattgagtctttgggtggatatgttgatgatggttatctgaatggtcagttaggggtcacccgtgcattagttgattggcatcttgaaggattgaaggatgagggtgaaaggggaggacccttgagtgctgaaccggaacttaaattgacaacactgaccaaggatgatgaattttttgtcattggtagtgatggaatatgggatgtgttcaccaacgaaaatgctgtagactttgctcgaaggaaactccaagagcacaatgatgtgaagctgtgttgcaagcacatagtagaggaggtaataaaacgaggcgcaaccgacaatttgacacttgttatggtagagtttccacttggagccacctccacatgtggtggtagaaaggtctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PP2C

Protein Analysis

215

Amino Acids

23.76

Weight (kDa)

5.22

Isoelectric Point (pI)

29.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019302)

Species Orthologous Gene IDs
prunus_persica Prupe.7G255800_v2.0.a1
rosa_laevigata RLG00000009207 RLG00000016426 RLG00000032266 RLG00000033392
rosa_multiflora Rmu_sc0001981.1_g000055
rosa_samantha Rh6AG178800 Rh6AG181000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 90, 486
AcsI RAATTY 2 cut(s) 109, 428
AcuI CTGAAG 1 cut(s) 42
AfaI GTAC 1 cut(s) 54
AflIII ACRYGT 1 cut(s) 626
AgsI TTSAA 2 cut(s) 344, 352
AluBI AGCT 3 cut(s) 20, 206, 529
AluI AGCT 3 cut(s) 20, 206, 529
Alw21I GWGCWC 1 cut(s) 516
ApeKI GCWGC 2 cut(s) 203, 237
ApoI RAATTY 2 cut(s) 109, 428
AspLEI GCGC 1 cut(s) 572
AspS9I GGNCC 1 cut(s) 374
AsuHPI GGTGA 3 cut(s) 307, 374, 460
AvaII GGWCC 1 cut(s) 374
BauI CACGAG 1 cut(s) 155
Bbv12I GWGCWC 1 cut(s) 516
BbvI GCAGC 2 cut(s) 215, 224
BccI CCATC 2 cut(s) 281, 443
BfaI CTAG 1 cut(s) 646
BfmI CTRYAG 2 cut(s) 207, 483
BisI GCNGC 2 cut(s) 204, 238
BlsI GCNGC 2 cut(s) 205, 239
BmcAI AGTACT 1 cut(s) 54
Bme18I GGWCC 1 cut(s) 374
BmgT120I GGNCC 1 cut(s) 374
BmiI GGNNCC 3 cut(s) 68, 376, 616
BmsI GCATC 1 cut(s) 346
BpmI CTGGAG 1 cut(s) 189
BpuEI CTTGAG 1 cut(s) 400
BsaBI GATNNNNATC 2 cut(s) 291, 336
BsaJI CCNNGG 1 cut(s) 417
BsaWI WCCGGW 2 cut(s) 69, 391
Bse8I GATNNNNATC 2 cut(s) 291, 336
BseDI CCNNGG 1 cut(s) 417
BseGI GGATG 3 cut(s) 361, 427, 466
BseJI GATNNNNATC 2 cut(s) 291, 336
BseMII CTCAG 1 cut(s) 157
BseRI GAGGAG 1 cut(s) 566
BseXI GCAGC 2 cut(s) 215, 224
BsiHKAI GWGCWC 1 cut(s) 516
BsiSI CCGG 2 cut(s) 70, 392
Bsp1286I GDGCHC 1 cut(s) 516
Bsp143I GATC 2 cut(s) 104, 223
BspCNI CTCAG 1 cut(s) 156
BspLI GGNNCC 3 cut(s) 68, 376, 616
BssECI CCNNGG 1 cut(s) 417
BssMI GATC 2 cut(s) 104, 223
BssSI CACGAG 1 cut(s) 155
BssT1I CCWWGG 1 cut(s) 417
Bst2BI CACGAG 1 cut(s) 155
BstC8I GCNNGC 1 cut(s) 539
BstDEI CTNAG 1 cut(s) 143
BstEII GGTNACC 1 cut(s) 313
BstF5I GGATG 3 cut(s) 361, 427, 466
BstHHI GCGC 1 cut(s) 572
BstKTI GATC 2 cut(s) 107, 226
BstMBI GATC 2 cut(s) 104, 223
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstNSI RCATGY 1 cut(s) 630
BstPI GGTNACC 1 cut(s) 313
BstSFI CTRYAG 2 cut(s) 207, 483
BstV1I GCAGC 2 cut(s) 215, 224
BtsCI GGATG 3 cut(s) 361, 427, 466
BtsIMutI CAGTG 1 cut(s) 410
Cac8I GCNNGC 1 cut(s) 539
CfoI GCGC 1 cut(s) 572
Cfr13I GGNCC 1 cut(s) 374
Csp6I GTAC 1 cut(s) 53
CviAII CATG 3 cut(s) 37, 43, 627
CviJI RGCY 6 cut(s) 20, 29, 182, 206, 529, 617
CviKI_1 RGCY 6 cut(s) 20, 29, 182, 206, 529, 617
CviQI GTAC 1 cut(s) 53
DdeI CTNAG 1 cut(s) 143
DpnI GATC 2 cut(s) 106, 225
DpnII GATC 2 cut(s) 104, 223
Eco130I CCWWGG 1 cut(s) 417
Eco47I GGWCC 1 cut(s) 374
Eco57I CTGAAG 1 cut(s) 42
Eco91I GGTNACC 1 cut(s) 313
EcoO109I RGGNCCY 1 cut(s) 374
EcoO65I GGTNACC 1 cut(s) 313
EcoT14I CCWWGG 1 cut(s) 417
ErhI CCWWGG 1 cut(s) 417
FaeI CATG 3 cut(s) 40, 46, 630
FatI CATG 3 cut(s) 36, 42, 626
FblI GTMKAC 2 cut(s) 90, 486
Fnu4HI GCNGC 2 cut(s) 204, 238
FokI GGATG 3 cut(s) 368, 434, 473
Fsp4HI GCNGC 2 cut(s) 204, 238
FspBI CTAG 1 cut(s) 646
GlaI GCGC 1 cut(s) 571
GluI GCNGC 2 cut(s) 204, 238
GsuI CTGGAG 1 cut(s) 189
HapII CCGG 2 cut(s) 70, 392
HhaI GCGC 1 cut(s) 572
Hin1II CATG 3 cut(s) 40, 46, 630
Hin6I GCGC 1 cut(s) 570
HinP1I GCGC 1 cut(s) 570
HinfI GANTC 1 cut(s) 263
HpaII CCGG 2 cut(s) 70, 392
HphI GGTGA 3 cut(s) 307, 374, 460
Hpy166II GTNNAC 3 cut(s) 91, 468, 487
Hpy188I TCNGA 2 cut(s) 17, 297
Hpy188III TCNNGA 2 cut(s) 192, 341
Hpy8I GTNNAC 3 cut(s) 91, 468, 487
Hpy99I CGWCG 2 cut(s) 17, 65
HpyAV CCTTC 3 cut(s) 338, 346, 492
HpyCH4IV ACGT 1 cut(s) 81
HpyCH4V TGCA 4 cut(s) 177, 240, 323, 537
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
HpyF3I CTNAG 1 cut(s) 143
HpySE526I ACGT 1 cut(s) 81
Hsp92II CATG 3 cut(s) 40, 46, 630
HspAI GCGC 1 cut(s) 570
Kzo9I GATC 2 cut(s) 104, 223
LmnI GCTCC 3 cut(s) 17, 200, 614
LpnPI CCDG 6 cut(s) 83, 130, 153, 163, 247, 405
Lsp1109I GCAGC 2 cut(s) 215, 224
LweI GCATC 1 cut(s) 346
MaeI CTAG 1 cut(s) 646
MaeII ACGT 1 cut(s) 81
MaeIII GTNAC 2 cut(s) 189, 313
MalI GATC 2 cut(s) 106, 225
MboI GATC 2 cut(s) 104, 223
MboII GAAGA 1 cut(s) 35
MhlI GDGCHC 1 cut(s) 516
MluCI AATT 5 cut(s) 109, 258, 401, 428, 580
MlyI GAGTC 1 cut(s) 272
MnlI CCTC 6 cut(s) 352, 365, 544, 547, 560, 631
MseI TTAA 2 cut(s) 114, 399
MslI CAYNNNNRTG 2 cut(s) 41, 519
MspI CCGG 2 cut(s) 70, 392
MwoI GCNNNNNNNGC 1 cut(s) 26
NdeII GATC 2 cut(s) 104, 223
NlaIII CATG 3 cut(s) 40, 46, 630
NlaIV GGNNCC 3 cut(s) 68, 376, 616
NmuCI GTSAC 2 cut(s) 189, 313
NspI RCATGY 1 cut(s) 630
PciI ACATGT 1 cut(s) 626
PkrI GCNGC 2 cut(s) 205, 239
PleI GAGTC 1 cut(s) 271
PpsI GAGTC 1 cut(s) 271
PpuMI RGGWCCY 1 cut(s) 374
PscI ACATGT 1 cut(s) 626
Psp5II RGGWCCY 1 cut(s) 374
PspEI GGTNACC 1 cut(s) 313
PspN4I GGNNCC 3 cut(s) 68, 376, 616
PspPI GGNCC 1 cut(s) 374
PspPPI RGGWCCY 1 cut(s) 374
RsaI GTAC 1 cut(s) 54
RsaNI GTAC 1 cut(s) 53
RseI CAYNNNNRTG 2 cut(s) 41, 519
SaqAI TTAA 2 cut(s) 114, 399
SatI GCNGC 2 cut(s) 204, 238
Sau3AI GATC 2 cut(s) 104, 223
Sau96I GGNCC 1 cut(s) 374
ScaI AGTACT 1 cut(s) 54
SchI GAGTC 1 cut(s) 272
SduI GDGCHC 1 cut(s) 516
SetI ASST 8 cut(s) 22, 84, 149, 208, 531, 558, 623, 645
SfaNI GCATC 1 cut(s) 346
SfcI CTRYAG 2 cut(s) 207, 483
SinI GGWCC 1 cut(s) 374
SmiMI CAYNNNNRTG 2 cut(s) 41, 519
SmlI CTYRAG 1 cut(s) 379
SmoI CTYRAG 1 cut(s) 379
Sse9I AATT 5 cut(s) 109, 258, 401, 428, 580
SspMI CTAG 1 cut(s) 646
StyI CCWWGG 1 cut(s) 417
TaiI ACGT 1 cut(s) 84
TaqI TCGA 3 cut(s) 60, 107, 496
TasI AATT 5 cut(s) 109, 258, 401, 428, 580
TatI WGTACW 1 cut(s) 52
Tru1I TTAA 2 cut(s) 114, 399
Tru9I TTAA 2 cut(s) 114, 399
TscAI CASTG 1 cut(s) 417
TseFI GTSAC 2 cut(s) 189, 313
TseI GCWGC 2 cut(s) 203, 237
Tsp45I GTSAC 2 cut(s) 189, 313
TspDTI ATGAA 1 cut(s) 441
TspRI CASTG 1 cut(s) 417
VpaK11BI GGWCC 1 cut(s) 374
XapI RAATTY 2 cut(s) 109, 428
XceI RCATGY 1 cut(s) 630
XmiI GTMKAC 2 cut(s) 90, 486
XspI CTAG 1 cut(s) 646
ZrmI AGTACT 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.