Rmu_sc0001986.1_g000032

ABC transporter B family member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001986.1
Physical Location & Seq
Reverse (-)
127606 .. 135810
8205 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001986.1_g000032.1.cds

Sequence Viewer

Length: 6372 bp
atggatgcagactcctcattcgagctggaaaactctatttccggccacctcccacgttacaccacccctgtggcaggctcgtcgcattatgactcccgctcattcacaccggttagctccgctcacttgagaactccgagaactcccagaaggtctcgccaccccactccaactacgcctttcgcctcggacaatgacatgtcgtggcaaggcgagatctcctggcagtttgagccgacggggtggaacgagactcgcaacttgggctcagctatgagcccatgggccaccgtgagcacgtcctctcgccaggcccagcgtgcccaccgctcagcaaattactactacctctcccgtaccactggcgggtttcgtacctccccaaatcaatattacaacgagtactccagctatggtgctgtgaccgatgggagacttgagcttaagagctacgttgctagggacaatgaaagctcaacttttgggaggagtagttacaattatggggagcagaagaaaccctttagggcagttactccaaggttggagggtattaaagaagcagctgggagtggaaatttcagtggcagtggccctttggctaagaaagatttgcttggtttgatcgattatcaaacagcagaagatgatgatgaagatgagagtttgggtcatagtggacaccatggtcatggcctatatcttgatcatggtcataggccatcacacaaaggacatgatcatgggttgtcacccatgggtcatcatggtcatgacacgtggccgcattcaattactagtcacgatattgatgatgagagtgatcagggttctgggtatgaggatgaggatgaggatgaggatgaggatgatgcaaggccagtgaagcaagttgggttgtttagcttgttcaagtactcaacaaaatgggatatgtttcttgtgtttttgggttgtgttggtgctcttatcaatggagggtctcttccttggtattcttatctctttggaaagtttgtgaataagattgctaaagaatcaaaggacgttgacaaaggccccatgatgagagatgtagagaagatatgcctgcttatgactggtttagctgcaatagtagtagttggagcatatatggactcctcattcgagctggaaaactctatttccggccacctcccacgttacaccacccctgtggcaggctcgtcgcattatgactcccgctcattcacaccggttagctccgctcacttgagaactccgagaactcccagaaggtctcgccaccccactccaactacgcctttcgcctcggacaatgacatgtcgtggcaaggcgagatctcctggcagtttgagccgacggggtggaacgagactcgcaacttgggctcagctatgagcccatgggccaccgtgagcacgtcctctcgccaggcccagcgtgcccaccgctcagcaaattactactacctctcccgtaccactggcgggtttcgtacctccccaaatcaatattacaacgagtactccagctatggtgctgtgaccgatgggagacttgagcttaagagctacgttgctagggacaatgaaagctcaacttttgggaggagtagttacaattatggggagcagaagaaaccctttagggcagttactccaaggttggagggtattaaagaagcagctgggagtggaaatttcagtggcagtggccctttggctaagaaagatttgcttggtttgatcgattatcaaacagcagaagatgatgatgaagatgagagtttgggtcatagtggacaccatggtcatggcctatatcttgatcatggtcataggccatcacacaaaggacatgatcatgggttgtcacccatgggtcatcatggtcatgacacgtggccgcattcaattactagtcacgatattgatgatgagagtgatcagggttctgggtatgaggatgaggatgaggatgaggatgaggatgatgcaaggccagtgaagcaagttgggttgtttagcttgttcaagtactcaacaaaatgggatatgtttcttgtgtttttgggttgtgttggtgctcttatcaatggagggtctcttccttggtattcttatctctttggaaagtttgtgaataagattgctaaagaatcaaaggacgttgacaaaggccccatgatgagagatgtagagaagatatgcctgcttatgactggtttagctgcaatagtagtagttggagcatatatggagatcacttgttggagaatggtgggggaaagatctgctcagagaataagaagagaatatctaaaagcagttctgcgacaagacattagcttttttgatactgagattgctgctggtgatattatgcatggaatttcaagtgatgttgctgcaatccaagaagtcatgggggagaagaagaaaccctttagggcagttactccaaggttggagggtattaaagaagcagctgggagtggaaatttcagtggcagtggccctttggctaagaaagatttgcttggtttgatcgattatcaaacagcagaagatgatgatgaagatgagagtttgggtcatagtggacaccatggtcatggcctatatcttgatcatggtcataggccatcacacaaaggacatgatcatgggttgtcacccatgggtcatcatggtcatgacacgtggccgcattcaattactagtcacgatattgatgatgagagtgatcagggttctgggtatgaggatgaggatgaggatgaggatgaggatgatgcaaggccagtgaagcaagttgggttgtttagcttgttcaagtactcaacaaaatgggatatgtttcttgtgtttttgggttgtgttggtgctcttatcaatggagggtctcttccttggtattcttatctctttggaaagtttgtgaataagattgctaaagaatcaaaggacgttgacaaaggccccatgatgagagatgtagagaagatatgcctgcttatgactggtttagctgcaatagtagtagttggagcatatatggagatcacttgttggagaatggtgggggaaagatctgctcagagaataagaagagaatatctaaaagcagttctgcgacaagacattagcttttttgatactgagattgctgctggtgatattatgcatggaatttcaagtgatgttgctgcaatccaagaagtcatgggggagaagatggcacatttcattcaccatatatgtaccttcatatgtggatacacagttgggtttctaaggacagctggtactgtagtcgagcaagctgtcagttcaatcagaacagtattttcctttgttgcggaggatcatttggctgaaaaatattctgcattaattgccaacttggtgccttttggagcaaagattggctttgctaagggtgcaggaatcggagttatctatcttgttagttattctacatgggcgttggctttctggtacggttctcttttggttgctaagggtgagatcactggaggtgctgccattgcttgtttctttggtgtaaatgtcgggggaaggggcttggcattgtcactgtcatactttgctcagtttgcacaagggaccgtagcagcaggccgagtatttgaaattatagatagagttccagaaatagatccctacagcccagtaggtaggaaactgtcaaatgttcgaggaaggattgaatttaaaggcatttatttcgcatacccgtctcgtcctgaagctccaatttttcattcgcttaatctggtcattccatcttcaaagacgctagcacttgttggctctagcggaggtggaaagtctacgatctttgctcttatagagagattctatgaccctaccaaaggtacaataacattggatggtcatgatttaaggtcacttcaggtgaagtggctaaggggtcagatgggcatggttggtcaggagccagtgctctttgccaccagcattttagaaaacgtgttgatggggaaagagaatgccaccaagaaagaagcaattactgcctgcattgctgccaatgctcacagcttcatttctggacttccgcatggctatgacactcaggttggagacagaggaacactactctcaggtggtcagaaacaaagaattgcattggctcgagcgatgatcaaggaccctagaatccttctcttggatgaacctaccagtgccttagaccctgaatccgagactgtagtccaacaggctattgacaaaatttcctcaggacgaacaactattgtaattgctcacaggctatcaactgtaagaaactctcatgccattgttgttcttgacagtggctctgtcattgagattggtaaccaccgccagctcatggaaaaagccggggcgtattatagcctcgttgagcttgcttctgatggagtgacaaaacctttttcggaacaatatgatactggaattagccctcagttttccaggtttgacaaatcagcttatgatgtatcaagatcaacattcatgcaagatcgaaaccaagtagaagagaaagaggtccaaaaaccaattccaagaaaggttcagctttcagatatatggttgttacagaggcctgagctcccaatgctattagttggatttcttttgggcatgcatgcaggtgcgattctatctatcttcccttatattctaggccaagcacttgtagtttattttgataaagagccatcaaagatcaaaacaggaatcgcgcccctttgcttagtacttgttgcacttggctttgggaatatactcttcatgacaggacaacaaggcttgtgtggctgggctggaacaaagctcacaatgagagtgagaaaccttcttttccgttccatacttaaacaagaacctggttggtttgattttgaagaaaactcaaaagcggtacttgtctctaggatttcaatggattctgtggcttttcgtgccgtccatgttgatcgattatcagtcttgtttatggggttgagttcagctatggttggattgggcatatccttttggcttgaatggaggctagctcttttggctgctgctctcactcctttcactcttggtgcaagttacttgagcttgatcataaatatagggcccaaacttgacaatgatgcttatgccaaggctagcaatattgcttctggtgcagtttcaaacataaggacggttgcaacattttctgctcaagaccagttgatcaagtcctttgatagtgctttatcggagccaaagacaaaatcaatgagaagaacgcaaataatgggcctagcactcgggttctctcaaggtgttatgtacggagcttacaccttaactctcttgtttggtgcttaccttatgaaagaaaacaaaactaatttcggtgatgtttacaaaatctttctcattcttgttctgagctcattttctgtgggacaattagccggtcttgcaccagacacatctatggctgaaacagcaattccagcagtttttgatatcatgactcgtaagcccttaatcagcagtgggagaggaaaggataagaagattgaaaggtcgaaacgtttagatattcacttcaaaatggtgacgtttgcatatccatcaaggcctgaggtaactgtgttgagtgaattttccctcaaggtcaaaggtggtagcacagtggcattggtgggtggaagtggatcgggaaaatcaactgtcatatggttaatacaaaggttttatgatccaactcaagggaaggtgatgatggggggagtggatttgagggagattgatgtgaagtggttaagaaggcaaacagctttagttggtcaagagcctacattgtttgctggcactataagagagaacattgcttttggtaacccggatgcttcatggactgaaattgaagatgctgcaagagaagcttacatccacagcttcattagtggcctccctcaaggctatgaaactcaggttggtgagagtggggttcagctatctggggggcagaagcaaaggattgccatagcaagagctatactgaagaaatcaaaggtactacttctagatgaagcaagtagtgcactagatttggaatctgagagacatatacaagacgcacttaggaaagtcagcaaaagggccacgacaatcatagtcgctcaccggctttctactatcagggaagctgatatgatagcagttatgaaagatggtggcatcactgaatatgggagccatgatacgctcatgaaatctcatcttaatggcgtgtatgccagcttggtgcgtgcagaaaccgaagccaatgcattttcttaa

Protein Analysis

2123

Amino Acids

233.6

Weight (kDa)

6.14

Isoelectric Point (pI)

35.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017342)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g35260
malus_domestica MD09G1177100.v1.1 MD17G1149200.v1.1
prunus_persica Prupe.3G036400_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0146621
rosa_laevigata RLG00000020211
rosa_multiflora Rmu_sc0001986.1_g000032
rosa_roxburghii Rroxscaffold_2G00100000
rosa_rugosa Rorug02G0395800 Rorug02G0395800
rosa_samantha Rh2BG464800 Rh2DG473800
rosa_wichuraiana Rw2G036930

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 4682
AasI GACNNNNNNGTC 3 cut(s) 687, 1815, 2616
Acc36I ACCTGC 1 cut(s) 4682
AccB1I GGYRCC 1 cut(s) 3415
AccB7I CCANNNNNTGG 1 cut(s) 4408
AccBSI CCGCTC 6 cut(s) 99, 122, 330, 1227, 1250, 1458
AccI GTMKAC 1 cut(s) 3863
AccII CGCG 1 cut(s) 4784
AclI AACGTT 1 cut(s) 5620
AclWI GGATC 4 cut(s) 3381, 3683, 5752, 5783
AcoI YGGCCR 5 cut(s) 43, 782, 1171, 1910, 2711
AcsI RAATTY 8 cut(s) 577, 1705, 2397, 2506, 3198, 3740, 4287, 5690
AcuI CTGAAG 3 cut(s) 3798, 3929, 6113
AcvI CACGTG 3 cut(s) 780, 1908, 2709
AfiI CCNNNNNNNGG 8 cut(s) 74, 366, 1202, 1494, 3905, 4222, 4408, 5798
AflII CTTAAG 2 cut(s) 443, 1571
AflIII ACRYGT 6 cut(s) 198, 777, 1326, 1905, 2706, 4023
AgeI ACCGGT 2 cut(s) 109, 1237
AhlI ACTAGT 3 cut(s) 797, 1925, 2726
AjiI CACGTC 2 cut(s) 300, 1428
AjnI CCWGG 6 cut(s) 221, 309, 1349, 1437, 4511, 4927
AjuI GAANNNNNNNTTGG 6 cut(s) 3778, 3810, 4584, 4616, 6009, 6041
AleI CACNNNNGTG 2 cut(s) 68, 1196
Alw21I GWGCWC 9 cut(s) 299, 967, 1427, 2095, 2896, 3999, 4653, 5477, 6136
Alw44I GTGCAC 1 cut(s) 6132
AlwI GGATC 4 cut(s) 3381, 3683, 5752, 5783
Ama87I CYCGRG 2 cut(s) 4188, 5348
ApaI GGGCCC 1 cut(s) 5172
ApaLI GTGCAC 1 cut(s) 6132
ApoI RAATTY 8 cut(s) 577, 1705, 2397, 2506, 3198, 3740, 4287, 5690
ArsI GACNNNNNNTTYG 3 cut(s) 34, 1130, 1162
AseI ATTAAT 1 cut(s) 3401
AsiGI ACCGGT 2 cut(s) 109, 1237
AspLEI GCGC 1 cut(s) 4786
AsuC2I CCSGG 2 cut(s) 4420, 5933
AsuNHI GCTAGC 3 cut(s) 3829, 5095, 5201
AvaI CYCGRG 2 cut(s) 4188, 5348
AvaII GGWCC 3 cut(s) 3636, 4204, 4588
AxyI CCTNAGG 2 cut(s) 4294, 5670
BaeGI GKGCMC 4 cut(s) 325, 1453, 5172, 6136
BaeI ACNNNNGTAYC 2 cut(s) 3306, 3339
BanI GGYRCC 1 cut(s) 3415
BanII GRGCYC 7 cut(s) 269, 281, 1397, 1409, 4653, 5172, 5477
BbrPI CACGTG 3 cut(s) 780, 1908, 2709
Bbv12I GWGCWC 9 cut(s) 299, 967, 1427, 2095, 2896, 3999, 4653, 5477, 6136
BceAI ACGGC 1 cut(s) 4991
BcgI CGANNNNNNTGC 7 cut(s) 63, 97, 1191, 1225, 3739, 3773, 6341
BciT130I CCWGG 6 cut(s) 223, 311, 1351, 1439, 4513, 4929
BciVI GTATCC 1 cut(s) 3278
BcnI CCSGG 2 cut(s) 4420, 5933
BcuI ACTAGT 3 cut(s) 797, 1925, 2726
BfmI CTRYAG 3 cut(s) 3318, 3694, 4263
BfrI CTTAAG 2 cut(s) 443, 1571
BfuAI ACCTGC 1 cut(s) 4682
BfuI GTATCC 1 cut(s) 3278
BglII AGATCT 4 cut(s) 216, 1344, 2297, 3098
BlpI GCTNAGC 4 cut(s) 268, 331, 1396, 1459
BmcAI AGTACT 6 cut(s) 404, 917, 1532, 2045, 2846, 4800
Bme1390I CCNGG 8 cut(s) 223, 311, 1351, 1439, 4420, 4513, 4929, 5933
Bme18I GGWCC 3 cut(s) 3636, 4204, 4588
BmeT110I CYCGRG 2 cut(s) 4188, 5348
BmgBI CACGTC 2 cut(s) 300, 1428
BmrFI CCNGG 8 cut(s) 223, 311, 1351, 1439, 4420, 4513, 4929, 5933
BmrI ACTGGG 1 cut(s) 3695
BmsI GCATC 7 cut(s) 862, 1990, 2791, 5176, 5926, 5950, 6279
BmtI GCTAGC 3 cut(s) 3833, 5099, 5205
BmuI ACTGGG 1 cut(s) 3695
BoxI GACNNNNGTC 1 cut(s) 4265
BplI GAGNNNNNCTC 2 cut(s) 5083, 5115
BpmI CTGGAG 3 cut(s) 391, 1519, 3564
Bpu10I CCTNAGC 4 cut(s) 3444, 3528, 3959, 4647
Bpu1102I GCTNAGC 4 cut(s) 268, 331, 1396, 1459
BpuMI CCSGG 2 cut(s) 4420, 5933
Bsa29I ATCGAT 4 cut(s) 627, 1755, 2556, 5020
BsaAI YACGTR 3 cut(s) 780, 1908, 2709
BsaI GGTCTC 5 cut(s) 159, 987, 1287, 2115, 2916
BsaWI WCCGGW 2 cut(s) 109, 1237
Bsc4I CCNNNNNNNGG 8 cut(s) 74, 366, 1202, 1494, 3905, 4222, 4408, 5798
Bse118I RCCGGY 4 cut(s) 109, 1237, 5498, 6216
Bse21I CCTNAGG 2 cut(s) 4294, 5670
Bse3DI GCAATG 3 cut(s) 3555, 4074, 5916
BseBI CCWGG 6 cut(s) 223, 311, 1351, 1439, 4513, 4929
BseCI ATCGAT 4 cut(s) 627, 1755, 2556, 5020
BseLI CCNNNNNNNGG 8 cut(s) 74, 366, 1202, 1494, 3905, 4222, 4408, 5798
BseMI GCAATG 3 cut(s) 3555, 4074, 5916
BseRI GAGGAG 4 cut(s) 4, 502, 1132, 1630
BseSI GKGCMC 4 cut(s) 325, 1453, 5172, 6136
BseYI CCCAGC 6 cut(s) 315, 566, 1443, 1694, 2495, 4860
BsgI GTGCAG 3 cut(s) 3471, 5241, 6363
Bsh1236I CGCG 1 cut(s) 4784
BshNI GGYRCC 1 cut(s) 3415
BshTI ACCGGT 2 cut(s) 109, 1237
BshVI ATCGAT 4 cut(s) 627, 1755, 2556, 5020
BsiHKAI GWGCWC 9 cut(s) 299, 967, 1427, 2095, 2896, 3999, 4653, 5477, 6136
BsiHKCI CYCGRG 2 cut(s) 4188, 5348
BsiSI CCGG 8 cut(s) 42, 110, 1170, 1238, 4419, 5499, 5933, 6217
BslFI GGGAC 4 cut(s) 476, 1604, 3649, 5502
BslI CCNNNNNNNGG 8 cut(s) 74, 366, 1202, 1494, 3905, 4222, 4408, 5798
BsmBI CGTCTC 1 cut(s) 3774
BsmFI GGGAC 4 cut(s) 476, 1604, 3649, 5502
BsmI GAATGC 4 cut(s) 787, 1915, 2716, 4048
Bso31I GGTCTC 5 cut(s) 159, 987, 1287, 2115, 2916
BsoBI CYCGRG 2 cut(s) 4188, 5348
Bsp120I GGGCCC 1 cut(s) 5168
Bsp1720I GCTNAGC 4 cut(s) 268, 331, 1396, 1459
Bsp19I CCATGG 8 cut(s) 281, 685, 756, 1409, 1813, 1884, 2614, 2685
BspDI ATCGAT 4 cut(s) 627, 1755, 2556, 5020
BspFNI CGCG 1 cut(s) 4784
BspHI TCATGA 7 cut(s) 772, 1900, 2701, 3928, 4833, 5556, 6300
BspMI ACCTGC 1 cut(s) 4682
BspOI GCTAGC 3 cut(s) 3833, 5099, 5205
BspPI GGATC 4 cut(s) 3381, 3683, 5752, 5783
BspT107I GGYRCC 1 cut(s) 3415
BspTI CTTAAG 2 cut(s) 443, 1571
BspTNI GGTCTC 5 cut(s) 159, 987, 1287, 2115, 2916
BsrBI CCGCTC 6 cut(s) 99, 122, 330, 1227, 1250, 1458
BsrDI GCAATG 3 cut(s) 3555, 4074, 5916
BsrFI RCCGGY 4 cut(s) 109, 1237, 5498, 6216
BssAI RCCGGY 4 cut(s) 109, 1237, 5498, 6216
Bst2UI CCWGG 6 cut(s) 223, 311, 1351, 1439, 4513, 4929
Bst6I CTCTTC 7 cut(s) 990, 2118, 2311, 2919, 3112, 4572, 4835
BstAFI CTTAAG 2 cut(s) 443, 1571
BstAPI GCANNNNNTGC 3 cut(s) 3404, 4067, 6131
BstBAI YACGTR 3 cut(s) 780, 1908, 2709
BstDSI CCRYGG 8 cut(s) 281, 685, 756, 1409, 1813, 1884, 2614, 2685
BstEII GGTNACC 2 cut(s) 4391, 5927
BstENI CCTNNNNNAGG 3 cut(s) 72, 1200, 3903
BstFNI CGCG 1 cut(s) 4784
BstHHI GCGC 1 cut(s) 4786
BstNI CCWGG 6 cut(s) 223, 311, 1351, 1439, 4513, 4929
BstNSI RCATGY 4 cut(s) 202, 1330, 4687, 4691
BstPAI GACNNNNGTC 1 cut(s) 4265
BstPI GGTNACC 2 cut(s) 4391, 5927
BstSCI CCNGG 8 cut(s) 221, 309, 1349, 1437, 4418, 4511, 4927, 5931
BstSFI CTRYAG 3 cut(s) 3318, 3694, 4263
BstSLI GKGCMC 4 cut(s) 325, 1453, 5172, 6136
BstUI CGCG 1 cut(s) 4784
BstX2I RGATCY 5 cut(s) 216, 1344, 2297, 3098, 3688
BstXI CCANNNNNNTGG 5 cut(s) 70, 692, 1198, 1820, 2621
BstYI RGATCY 5 cut(s) 216, 1344, 2297, 3098, 3688
Bsu15I ATCGAT 4 cut(s) 627, 1755, 2556, 5020
Bsu36I CCTNAGG 2 cut(s) 4294, 5670
BsuI GTATCC 1 cut(s) 3278
BsuTUI ATCGAT 4 cut(s) 627, 1755, 2556, 5020
BtgI CCRYGG 8 cut(s) 281, 685, 756, 1409, 1813, 1884, 2614, 2685
BtgZI GCGATG 1 cut(s) 4208
BtrI CACGTC 2 cut(s) 300, 1428
BtsI GCAGTG 4 cut(s) 595, 1723, 2524, 5587
BveI ACCTGC 1 cut(s) 4682
CciI TCATGA 7 cut(s) 772, 1900, 2701, 3928, 4833, 5556, 6300
CfoI GCGC 1 cut(s) 4786
Cfr10I RCCGGY 4 cut(s) 109, 1237, 5498, 6216
ClaI ATCGAT 4 cut(s) 627, 1755, 2556, 5020
CseI GACGC 2 cut(s) 3835, 6176
CsiI ACCWGGT 1 cut(s) 4927
CspAI ACCGGT 2 cut(s) 109, 1237
DraI TTTAAA 1 cut(s) 3745
DrdI GACNNNNNNGTC 3 cut(s) 687, 1815, 2616
DseDI GACNNNNNNGTC 3 cut(s) 687, 1815, 2616
EaeI YGGCCR 5 cut(s) 43, 782, 1171, 1910, 2711
Eam1104I CTCTTC 7 cut(s) 990, 2118, 2311, 2919, 3112, 4572, 4835
EarI CTCTTC 7 cut(s) 990, 2118, 2311, 2919, 3112, 4572, 4835
Ecl136II GAGCTC 2 cut(s) 4651, 5475
Eco147I AGGCCT 2 cut(s) 4645, 5668
Eco24I GRGCYC 7 cut(s) 269, 281, 1397, 1409, 4653, 5172, 5477
Eco31I GGTCTC 5 cut(s) 159, 987, 1287, 2115, 2916
Eco32I GATATC 1 cut(s) 5554
Eco47I GGWCC 3 cut(s) 3636, 4204, 4588
Eco53kI GAGCTC 2 cut(s) 4651, 5475
Eco57I CTGAAG 3 cut(s) 3798, 3929, 6113
Eco72I CACGTG 3 cut(s) 780, 1908, 2709
Eco81I CCTNAGG 2 cut(s) 4294, 5670
Eco88I CYCGRG 2 cut(s) 4188, 5348
Eco91I GGTNACC 2 cut(s) 4391, 5927
EcoICRI GAGCTC 2 cut(s) 4651, 5475
EcoNI CCTNNNNNAGG 3 cut(s) 72, 1200, 3903
EcoO109I RGGNCCY 5 cut(s) 1058, 2186, 2987, 4204, 5168
EcoO65I GGTNACC 2 cut(s) 4391, 5927
EcoRII CCWGG 6 cut(s) 221, 309, 1349, 1437, 4511, 4927
EcoRV GATATC 1 cut(s) 5554
EcoT22I ATGCAT 4 cut(s) 2394, 3195, 4689, 6364
EcoT38I GRGCYC 7 cut(s) 269, 281, 1397, 1409, 4653, 5172, 5477
Esp3I CGTCTC 1 cut(s) 3774
FaqI GGGAC 4 cut(s) 476, 1604, 3649, 5502
FauI CCCGC 4 cut(s) 104, 359, 1232, 1487
FauNDI CATATG 2 cut(s) 3278, 5765
FblI GTMKAC 1 cut(s) 3863
FriOI GRGCYC 7 cut(s) 269, 281, 1397, 1409, 4653, 5172, 5477
GlaI GCGC 1 cut(s) 4785
GsaI CCCAGC 6 cut(s) 319, 570, 1447, 1698, 2499, 4864
GsuI CTGGAG 3 cut(s) 391, 1519, 3564
HapII CCGG 8 cut(s) 42, 110, 1170, 1238, 4419, 5499, 5933, 6217
HgaI GACGC 2 cut(s) 3835, 6176
HhaI GCGC 1 cut(s) 4786
Hin6I GCGC 1 cut(s) 4784
HinP1I GCGC 1 cut(s) 4784
HincII GTYRAC 3 cut(s) 1051, 2179, 2980
HindII GTYRAC 3 cut(s) 1051, 2179, 2980
HindIII AAGCTT 1 cut(s) 5973
HpaII CCGG 8 cut(s) 42, 110, 1170, 1238, 4419, 5499, 5933, 6217
Hpy166II GTNNAC 9 cut(s) 680, 1051, 1808, 2179, 2609, 2980, 3864, 5446, 6134
Hpy8I GTNNAC 9 cut(s) 680, 1051, 1808, 2179, 2609, 2980, 3864, 5446, 6134
Hpy99I CGWCG 4 cut(s) 85, 241, 1213, 1369
HpyAV CCTTC 9 cut(s) 144, 1272, 3283, 3582, 3726, 4226, 4907, 5797, 5850
HspAI GCGC 1 cut(s) 4784
LweI GCATC 7 cut(s) 862, 1990, 2791, 5176, 5926, 5950, 6279
MabI ACCWGGT 1 cut(s) 4927
MbiI CCGCTC 6 cut(s) 99, 122, 330, 1227, 1250, 1458
MflI RGATCY 5 cut(s) 216, 1344, 2297, 3098, 3688
MlyI GAGTC 7 cut(s) 5, 86, 247, 1133, 1214, 1375, 5554
Mph1103I ATGCAT 4 cut(s) 2394, 3195, 4689, 6364
MspA1I CMGCKG 4 cut(s) 566, 1694, 2495, 3311
MspCI CTTAAG 2 cut(s) 443, 1571
MspI CCGG 8 cut(s) 42, 110, 1170, 1238, 4419, 5499, 5933, 6217
MspR9I CCNGG 8 cut(s) 223, 311, 1351, 1439, 4420, 4513, 4929, 5933
Mva1269I GAATGC 4 cut(s) 787, 1915, 2716, 4048
MvaI CCWGG 6 cut(s) 223, 311, 1351, 1439, 4513, 4929
MvnI CGCG 1 cut(s) 4784
NciI CCSGG 2 cut(s) 4420, 5933
NcoI CCATGG 8 cut(s) 281, 685, 756, 1409, 1813, 1884, 2614, 2685
NdeI CATATG 2 cut(s) 3278, 5765
NheI GCTAGC 3 cut(s) 3829, 5095, 5201
NmeAIII GCCGAG 1 cut(s) 3677
NsiI ATGCAT 4 cut(s) 2394, 3195, 4689, 6364
NspI RCATGY 4 cut(s) 202, 1330, 4687, 4691
OliI CACNNNNGTG 2 cut(s) 68, 1196
PaeI GCATGC 2 cut(s) 4687, 4691
PaeR7I CTCGAG 1 cut(s) 4188
PagI TCATGA 7 cut(s) 772, 1900, 2701, 3928, 4833, 5556, 6300
PaqCI CACCTGC 1 cut(s) 4682
PceI AGGCCT 2 cut(s) 4645, 5668
PciI ACATGT 2 cut(s) 198, 1326
PctI GAATGC 4 cut(s) 787, 1915, 2716, 4048
PflMI CCANNNNNTGG 1 cut(s) 4408
PinAI ACCGGT 2 cut(s) 109, 1237
PleI GAGTC 7 cut(s) 5, 86, 247, 1133, 1214, 1375, 5554
PmaCI CACGTG 3 cut(s) 780, 1908, 2709
PmlI CACGTG 3 cut(s) 780, 1908, 2709
PpsI GAGTC 7 cut(s) 5, 86, 247, 1133, 1214, 1375, 5554
Ppu21I YACGTR 3 cut(s) 780, 1908, 2709
PpuMI RGGWCCY 1 cut(s) 4204
PscI ACATGT 2 cut(s) 198, 1326
PshAI GACNNNNGTC 1 cut(s) 4265
PshBI ATTAAT 1 cut(s) 3401
Psp124BI GAGCTC 2 cut(s) 4653, 5477
Psp1406I AACGTT 1 cut(s) 5620
Psp5II RGGWCCY 1 cut(s) 4204
Psp6I CCWGG 6 cut(s) 221, 309, 1349, 1437, 4511, 4927
PspCI CACGTG 3 cut(s) 780, 1908, 2709
PspEI GGTNACC 2 cut(s) 4391, 5927
PspFI CCCAGC 6 cut(s) 315, 566, 1443, 1694, 2495, 4860
PspGI CCWGG 6 cut(s) 221, 309, 1349, 1437, 4511, 4927
PspOMI GGGCCC 1 cut(s) 5168
PspPPI RGGWCCY 1 cut(s) 4204
PspXI VCTCGAGB 1 cut(s) 4188
PsuI RGATCY 5 cut(s) 216, 1344, 2297, 3098, 3688
PvuII CAGCTG 4 cut(s) 566, 1694, 2495, 3311
SacI GAGCTC 2 cut(s) 4653, 5477
ScaI AGTACT 6 cut(s) 404, 917, 1532, 2045, 2846, 4800
SchI GAGTC 7 cut(s) 5, 86, 247, 1133, 1214, 1375, 5554
ScrFI CCNGG 8 cut(s) 223, 311, 1351, 1439, 4420, 4513, 4929, 5933
SexAI ACCWGGT 1 cut(s) 4927
SfaNI GCATC 7 cut(s) 862, 1990, 2791, 5176, 5926, 5950, 6279
SfcI CTRYAG 3 cut(s) 3318, 3694, 4263
Sfr274I CTCGAG 1 cut(s) 4188
SinI GGWCC 3 cut(s) 3636, 4204, 4588
SlaI CTCGAG 1 cut(s) 4188
SpeI ACTAGT 3 cut(s) 797, 1925, 2726
SphI GCATGC 2 cut(s) 4687, 4691
SseBI AGGCCT 2 cut(s) 4645, 5668
SspI AATATT 4 cut(s) 392, 1520, 3392, 5209
SstI GAGCTC 2 cut(s) 4653, 5477
StuI AGGCCT 2 cut(s) 4645, 5668
StyD4I CCNGG 8 cut(s) 221, 309, 1349, 1437, 4418, 4511, 4927, 5931
TaqII GACCGA 2 cut(s) 440, 1568
TatI WGTACW 6 cut(s) 402, 915, 1530, 2043, 2844, 4798
TauI GCSGC 3 cut(s) 787, 1915, 2716
TspGWI ACGGA 2 cut(s) 4895, 5388
Van91I CCANNNNNTGG 1 cut(s) 4408
Vha464I CTTAAG 2 cut(s) 443, 1571
VneI GTGCAC 1 cut(s) 6132
VpaK11BI GGWCC 3 cut(s) 3636, 4204, 4588
VspI ATTAAT 1 cut(s) 3401
XagI CCTNNNNNAGG 3 cut(s) 72, 1200, 3903
XapI RAATTY 8 cut(s) 577, 1705, 2397, 2506, 3198, 3740, 4287, 5690
XbaI TCTAGA 1 cut(s) 6115
XceI RCATGY 4 cut(s) 202, 1330, 4687, 4691
XhoI CTCGAG 1 cut(s) 4188
XmiI GTMKAC 1 cut(s) 3863
ZrmI AGTACT 6 cut(s) 404, 917, 1532, 2045, 2846, 4800
Zsp2I ATGCAT 4 cut(s) 2394, 3195, 4689, 6364
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.