Rmu_sc0002277.1_g000013

Belongs to the peptidase C1 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002277.1
Physical Location & Seq
Forward (+)
61022 .. 61369
348 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002277.1_g000013.1.cds

Sequence Viewer

Length: 348 bp
ctggtcaatcacgaagatgtgcttgcaaatagtgaaagtgcccttcttaaggtcgttgctaatgaacccatttctgttgccattgatgctagtagttcggatttccaattctattcaagtggtgttttcacaggaacttgtggaacaagcggtctgccattgatgataaaccatggtgttaccgcagtaggttatggcgttagcgatgatgggactaggtattggttggttaagaactcatggggggcacaatggggtgaagaagggtacataagaatgcaaagagatgttgctgagaaggaaggcctgtgtggtattgctatggcagcctcttatcccactacatag

Protein Analysis

115

Amino Acids

12.24

Weight (kDa)

4.49

Isoelectric Point (pI)

15.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019743)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 150, 183
AfaI GTAC 1 cut(s) 269
AfiI CCNNNNNNNGG 1 cut(s) 49
AflII CTTAAG 1 cut(s) 47
AgsI TTSAA 1 cut(s) 117
AoxI GGCC 1 cut(s) 304
ApeKI GCWGC 1 cut(s) 326
AsuHPI GGTGA 1 cut(s) 269
BaeGI GKGCMC 2 cut(s) 43, 250
BbvI GCAGC 1 cut(s) 338
BccI CCATC 1 cut(s) 203
BfaI CTAG 2 cut(s) 90, 216
BfrI CTTAAG 1 cut(s) 47
BisI GCNGC 1 cut(s) 327
BlsI GCNGC 1 cut(s) 328
BmsI GCATC 1 cut(s) 76
BsaJI CCNNGG 1 cut(s) 172
Bsc4I CCNNNNNNNGG 1 cut(s) 49
BseDI CCNNGG 1 cut(s) 172
BseLI CCNNNNNNNGG 1 cut(s) 49
BseMII CTCAG 1 cut(s) 285
BseSI GKGCMC 2 cut(s) 43, 250
BseXI GCAGC 1 cut(s) 338
BshFI GGCC 1 cut(s) 306
BslFI GGGAC 1 cut(s) 226
BslI CCNNNNNNNGG 1 cut(s) 49
BsmFI GGGAC 1 cut(s) 226
BsmI GAATGC 1 cut(s) 282
BsnI GGCC 1 cut(s) 306
Bsp1286I GDGCHC 2 cut(s) 43, 250
Bsp19I CCATGG 1 cut(s) 172
BspACI CCGC 2 cut(s) 150, 183
BspANI GGCC 1 cut(s) 306
BspCNI CTCAG 1 cut(s) 286
BspTI CTTAAG 1 cut(s) 47
BssECI CCNNGG 1 cut(s) 172
BssT1I CCWWGG 1 cut(s) 172
BstAFI CTTAAG 1 cut(s) 47
BstC8I GCNNGC 1 cut(s) 24
BstDEI CTNAG 1 cut(s) 294
BstDSI CCRYGG 1 cut(s) 172
BstENI CCTNNNNNAGG 1 cut(s) 47
BstMWI GCNNNNNNNGC 2 cut(s) 86, 326
BstSLI GKGCMC 2 cut(s) 43, 250
BstV1I GCAGC 1 cut(s) 338
BsuRI GGCC 1 cut(s) 306
BtgI CCRYGG 1 cut(s) 172
BtgZI GCGATG 1 cut(s) 219
Cac8I GCNNGC 1 cut(s) 24
Csp6I GTAC 1 cut(s) 268
CviAII CATG 2 cut(s) 173, 240
CviJI RGCY 2 cut(s) 306, 329
CviKI_1 RGCY 2 cut(s) 306, 329
CviQI GTAC 1 cut(s) 268
DdeI CTNAG 1 cut(s) 294
Eco130I CCWWGG 1 cut(s) 172
Eco147I AGGCCT 1 cut(s) 306
EcoNI CCTNNNNNAGG 1 cut(s) 47
EcoT14I CCWWGG 1 cut(s) 172
ErhI CCWWGG 1 cut(s) 172
FaeI CATG 2 cut(s) 176, 243
FaiI YATR 6 cut(s) 174, 195, 241, 272, 323, 346
FalI AAGNNNNNCTT 1 cut(s) 38
FaqI GGGAC 1 cut(s) 226
FatI CATG 2 cut(s) 172, 239
Fnu4HI GCNGC 1 cut(s) 327
Fsp4HI GCNGC 1 cut(s) 327
FspBI CTAG 2 cut(s) 90, 216
GluI GCNGC 1 cut(s) 327
HaeIII GGCC 1 cut(s) 306
Hin1II CATG 2 cut(s) 176, 243
HphI GGTGA 1 cut(s) 269
Hpy188I TCNGA 1 cut(s) 100
Hpy188III TCNNGA 1 cut(s) 11
HpyAV CCTTC 4 cut(s) 53, 257, 292, 296
HpyCH4V TGCA 2 cut(s) 26, 280
HpyF10VI GCNNNNNNNGC 2 cut(s) 86, 326
HpyF3I CTNAG 1 cut(s) 294
Hsp92II CATG 2 cut(s) 176, 243
LpnPI CCDG 2 cut(s) 117, 320
Lsp1109I GCAGC 1 cut(s) 338
LweI GCATC 1 cut(s) 76
MaeI CTAG 2 cut(s) 90, 216
MaeIII GTNAC 1 cut(s) 178
MboII GAAGA 2 cut(s) 26, 272
MhlI GDGCHC 2 cut(s) 43, 250
MluCI AATT 1 cut(s) 107
MnlI CCTC 1 cut(s) 340
MseI TTAA 2 cut(s) 48, 231
MslI CAYNNNNRTG 2 cut(s) 15, 275
MspCI CTTAAG 1 cut(s) 47
Mva1269I GAATGC 1 cut(s) 282
MwoI GCNNNNNNNGC 2 cut(s) 86, 326
NcoI CCATGG 1 cut(s) 172
NlaIII CATG 2 cut(s) 176, 243
PceI AGGCCT 1 cut(s) 306
PctI GAATGC 1 cut(s) 282
PkrI GCNGC 1 cut(s) 328
RsaI GTAC 1 cut(s) 269
RsaNI GTAC 1 cut(s) 268
RseI CAYNNNNRTG 2 cut(s) 15, 275
SaqAI TTAA 2 cut(s) 48, 231
SatI GCNGC 1 cut(s) 327
SduI GDGCHC 2 cut(s) 43, 250
SetI ASST 3 cut(s) 54, 193, 221
SfaNI GCATC 1 cut(s) 76
SmiMI CAYNNNNRTG 2 cut(s) 15, 275
SmlI CTYRAG 1 cut(s) 47
SmoI CTYRAG 1 cut(s) 47
Sse9I AATT 1 cut(s) 107
SseBI AGGCCT 1 cut(s) 306
SsiI CCGC 2 cut(s) 150, 183
SspMI CTAG 2 cut(s) 90, 216
StuI AGGCCT 1 cut(s) 306
StyI CCWWGG 1 cut(s) 172
TasI AATT 1 cut(s) 107
Tru1I TTAA 2 cut(s) 48, 231
Tru9I TTAA 2 cut(s) 48, 231
TseI GCWGC 1 cut(s) 326
TspDTI ATGAA 1 cut(s) 78
Vha464I CTTAAG 1 cut(s) 47
XagI CCTNNNNNAGG 1 cut(s) 47
XspI CTAG 2 cut(s) 90, 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.