Rmu_sc0002307.1_g000011

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002307.1
OG0020065
Physical Location & Seq
Forward (+)
88064 .. 88486
423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002307.1_g000011.1.cds

Sequence Viewer

Length: 339 bp
atgtcgaatgaacttagactcgactttcccgtgcttgactcaacaggcttagattaccacagttgggtaactgatgttgagaaccatctcacttcaaagggaatattacccataatccaggcacctaacccggatcttgtgttcatcaaggatgcaagagagctatgggtagcgctagaagagcgttttggtaatgtccaagattccctcctccctgacttgaaggttcaatggaacaatctgcgctttgatgatttcaagtatgttgctgaatataatttagaggctcttagcttacaatccatgttgagattctgtggacaacctgtcacagaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

112

Amino Acids

12.95

Weight (kDa)

4.5

Isoelectric Point (pI)

42.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 121
AclWI GGATC 1 cut(s) 141
AfeI AGCGCT 1 cut(s) 174
AfiI CCNNNNNNNGG 1 cut(s) 64
AgsI TTSAA 4 cut(s) 96, 223, 230, 259
AhdI GACNNNNNGTC 1 cut(s) 326
AjnI CCWGG 1 cut(s) 117
AjuI GAANNNNNNNTTGG 2 cut(s) 171, 203
AloI GAACNNNNNNTCC 2 cut(s) 125, 157
AluBI AGCT 2 cut(s) 163, 294
AluI AGCT 2 cut(s) 163, 294
AlwI GGATC 1 cut(s) 141
Aor51HI AGCGCT 1 cut(s) 174
AspLEI GCGC 2 cut(s) 175, 246
AsuC2I CCSGG 1 cut(s) 131
BanI GGYRCC 1 cut(s) 121
BccI CCATC 1 cut(s) 93
BciT130I CCWGG 1 cut(s) 119
BcnI CCSGG 1 cut(s) 131
BfaI CTAG 1 cut(s) 176
BfoI RGCGCY 1 cut(s) 176
Bme1390I CCNGG 2 cut(s) 119, 131
BmeRI GACNNNNNGTC 1 cut(s) 326
BmiI GGNNCC 1 cut(s) 123
BmrFI CCNGG 2 cut(s) 119, 131
BmsI GCATC 1 cut(s) 142
BpuMI CCSGG 1 cut(s) 131
Bsc4I CCNNNNNNNGG 1 cut(s) 64
BseBI CCWGG 1 cut(s) 119
BseGI GGATG 1 cut(s) 157
BseLI CCNNNNNNNGG 1 cut(s) 64
BseRI GAGGAG 1 cut(s) 200
BshNI GGYRCC 1 cut(s) 121
BsiSI CCGG 1 cut(s) 131
BslI CCNNNNNNNGG 1 cut(s) 64
Bsp143I GATC 1 cut(s) 133
BspLI GGNNCC 1 cut(s) 123
BspPI GGATC 1 cut(s) 141
BspQI GCTCTTC 1 cut(s) 174
BspT107I GGYRCC 1 cut(s) 121
BssMI GATC 1 cut(s) 133
Bst2UI CCWGG 1 cut(s) 119
Bst4CI ACNGT 1 cut(s) 62
Bst6I CTCTTC 1 cut(s) 174
BstDEI CTNAG 3 cut(s) 14, 49, 290
BstF5I GGATG 1 cut(s) 157
BstH2I RGCGCY 1 cut(s) 176
BstHHI GCGC 2 cut(s) 175, 246
BstKTI GATC 1 cut(s) 136
BstMBI GATC 1 cut(s) 133
BstMWI GCNNNNNNNGC 1 cut(s) 181
BstNI CCWGG 1 cut(s) 119
BstSCI CCNGG 2 cut(s) 117, 129
BstX2I RGATCY 1 cut(s) 133
BstYI RGATCY 1 cut(s) 133
BtsCI GGATG 1 cut(s) 157
CfoI GCGC 2 cut(s) 175, 246
CviAII CATG 1 cut(s) 304
CviJI RGCY 4 cut(s) 48, 163, 287, 294
CviKI_1 RGCY 4 cut(s) 48, 163, 287, 294
DdeI CTNAG 3 cut(s) 14, 49, 290
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
DriI GACNNNNNGTC 1 cut(s) 326
Eam1104I CTCTTC 1 cut(s) 174
Eam1105I GACNNNNNGTC 1 cut(s) 326
EarI CTCTTC 1 cut(s) 174
Eco47III AGCGCT 1 cut(s) 174
EcoRII CCWGG 1 cut(s) 117
FaeI CATG 1 cut(s) 307
FaiI YATR 5 cut(s) 113, 166, 264, 276, 305
FatI CATG 1 cut(s) 303
FokI GGATG 1 cut(s) 164
FspBI CTAG 1 cut(s) 176
GlaI GCGC 2 cut(s) 174, 245
HaeII RGCGCY 1 cut(s) 176
HapII CCGG 1 cut(s) 131
HhaI GCGC 2 cut(s) 175, 246
Hin1II CATG 1 cut(s) 307
Hin6I GCGC 2 cut(s) 173, 244
HinP1I GCGC 2 cut(s) 173, 244
HinfI GANTC 4 cut(s) 18, 38, 203, 312
HpaII CCGG 1 cut(s) 131
Hpy166II GTNNAC 1 cut(s) 320
Hpy8I GTNNAC 1 cut(s) 320
HpyAV CCTTC 1 cut(s) 217
HpyCH4III ACNGT 1 cut(s) 62
HpyCH4V TGCA 1 cut(s) 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 181
HpyF3I CTNAG 3 cut(s) 14, 49, 290
Hsp92II CATG 1 cut(s) 307
HspAI GCGC 2 cut(s) 173, 244
Kzo9I GATC 1 cut(s) 133
LguI GCTCTTC 1 cut(s) 174
LpnPI CCDG 5 cut(s) 30, 104, 131, 144, 228
LweI GCATC 1 cut(s) 142
MaeI CTAG 1 cut(s) 176
MaeIII GTNAC 2 cut(s) 67, 328
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MboII GAAGA 1 cut(s) 191
MflI RGATCY 1 cut(s) 133
MluCI AATT 1 cut(s) 277
MlyI GAGTC 2 cut(s) 12, 32
MnlI CCTC 3 cut(s) 218, 221, 277
MspI CCGG 1 cut(s) 131
MspR9I CCNGG 2 cut(s) 119, 131
MvaI CCWGG 1 cut(s) 119
MwoI GCNNNNNNNGC 1 cut(s) 181
NciI CCSGG 1 cut(s) 131
NdeII GATC 1 cut(s) 133
NlaIII CATG 1 cut(s) 307
NlaIV GGNNCC 1 cut(s) 123
NmuCI GTSAC 1 cut(s) 328
PciSI GCTCTTC 1 cut(s) 174
PcsI WCGNNNNNNNCGW 1 cut(s) 27
PfeI GAWTC 2 cut(s) 203, 312
PleI GAGTC 2 cut(s) 12, 32
PpsI GAGTC 2 cut(s) 12, 32
Psp6I CCWGG 1 cut(s) 117
PspGI CCWGG 1 cut(s) 117
PspN4I GGNNCC 1 cut(s) 123
PsuI RGATCY 1 cut(s) 133
SapI GCTCTTC 1 cut(s) 174
Sau3AI GATC 1 cut(s) 133
SchI GAGTC 2 cut(s) 12, 32
ScrFI CCNGG 2 cut(s) 119, 131
SetI ASST 5 cut(s) 127, 165, 228, 296, 328
SfaNI GCATC 1 cut(s) 142
Sse9I AATT 1 cut(s) 277
SspI AATATT 1 cut(s) 105
SspMI CTAG 1 cut(s) 176
StyD4I CCNGG 2 cut(s) 117, 129
TaaI ACNGT 1 cut(s) 62
TaqI TCGA 2 cut(s) 5, 21
TasI AATT 1 cut(s) 277
TfiI GAWTC 2 cut(s) 203, 312
TseFI GTSAC 1 cut(s) 328
Tsp45I GTSAC 1 cut(s) 328
TspDTI ATGAA 2 cut(s) 24, 133
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.