Rmu_sc0007021.1_g000004

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007021.1
OG0020065
Physical Location & Seq
Forward (+)
13599 .. 16070
2472 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007021.1_g000004.1.cds

Sequence Viewer

Length: 810 bp
atgagacagttacatgagcagattcagcacattcaaagctatcaaccaggtacttctcctcctcctaatggctctcttgaattttccttgatctcccaacttgaatcgttgtttcgggatgaagaattgtttggggctcaacgtgctaaaactaattgggatgatctcaataattggaccaatgatcaagatcatattgcttcgatccttatcaatgcttttcaaaaacgttttacgtcttctaccactccttctcatgcgttagcatcttttctctcatttatccaaccttgcatttctgagcatgataatgtctcgttattggctccggtctcattggatgatgtttttaaggcggttcatagtattggagctttgaaagccccgggtccggatgcccttgagcacccatgtgcctcctattgcccctgcagcatagtcgcacgcctgctgcccctgcagcacagcagcacgctctttcctgtgcagatcaacctgatgtcgaatgaacctagactcgactttaccatgcttgactcaacaggctcggattactacaattgggtaaccgatgttgagaaccacctcacttcaaatggaatattacccataatccaggcacctaacttggatcgtgtattggagtatatgtggatcaaggatgcaagagagctatgggtagcgctagaagagcgttttggcaatgtccaagattccctcctccctgacttgaaggttcaatggaacaatctgcgctttgctaatttcaagtctgttgctgaatataattcagaagctcttcgcctatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

269

Amino Acids

30.44

Weight (kDa)

4.93

Isoelectric Point (pI)

36.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 619
AccIII TCCGGA 1 cut(s) 391
AciI CCGC 1 cut(s) 356
AclI AACGTT 1 cut(s) 229
AclWI GGATC 3 cut(s) 199, 639, 662
AcsI RAATTY 1 cut(s) 80
AfaI GTAC 1 cut(s) 52
AfeI AGCGCT 1 cut(s) 684
AfiI CCNNNNNNNGG 2 cut(s) 68, 391
AgsI TTSAA 9 cut(s) 35, 80, 104, 224, 379, 594, 733, 740, 769
AjnI CCWGG 2 cut(s) 46, 615
AjuI GAANNNNNNNTTGG 4 cut(s) 114, 146, 681, 713
AleI CACNNNNGTG 1 cut(s) 411
AluBI AGCT 4 cut(s) 39, 374, 673, 797
AluI AGCT 4 cut(s) 39, 374, 673, 797
Alw21I GWGCWC 1 cut(s) 408
Alw26I GTCTC 2 cut(s) 319, 337
AlwI GGATC 3 cut(s) 199, 639, 662
Ama87I CYCGRG 1 cut(s) 385
Aor13HI TCCGGA 1 cut(s) 391
Aor51HI AGCGCT 1 cut(s) 684
ApeKI GCWGC 4 cut(s) 432, 451, 460, 468
ApoI RAATTY 1 cut(s) 80
Asp700I GAANNNNTTC 1 cut(s) 798
AspLEI GCGC 2 cut(s) 685, 756
AspS9I GGNCC 2 cut(s) 177, 389
AsuC2I CCSGG 2 cut(s) 386, 387
AvaI CYCGRG 1 cut(s) 385
AvaII GGWCC 2 cut(s) 177, 389
BanI GGYRCC 1 cut(s) 619
BanII GRGCYC 1 cut(s) 139
BbsI GAAGAC 1 cut(s) 231
Bbv12I GWGCWC 1 cut(s) 408
BbvI GCAGC 4 cut(s) 438, 444, 472, 480
BcgI CGANNNNNNTGC 2 cut(s) 421, 455
BciT130I CCWGG 2 cut(s) 48, 617
BclI TGATCA 1 cut(s) 184
BcnI CCSGG 2 cut(s) 386, 387
BcoDI GTCTC 2 cut(s) 319, 337
BfaI CTAG 2 cut(s) 513, 686
BfmI CTRYAG 3 cut(s) 430, 458, 806
BfoI RGCGCY 1 cut(s) 686
BisI GCNGC 4 cut(s) 433, 452, 461, 469
BlsI GCNGC 4 cut(s) 434, 453, 462, 470
Bme1390I CCNGG 4 cut(s) 48, 386, 387, 617
Bme18I GGWCC 2 cut(s) 177, 389
BmeT110I CYCGRG 1 cut(s) 385
BmgT120I GGNCC 2 cut(s) 177, 389
BmiI GGNNCC 3 cut(s) 327, 390, 621
BmrFI CCNGG 4 cut(s) 48, 386, 387, 617
BmsI GCATC 3 cut(s) 275, 385, 652
BpiI GAAGAC 1 cut(s) 231
BpuEI CTTGAG 1 cut(s) 422
BpuMI CCSGG 2 cut(s) 386, 387
BsaBI GATNNNNATC 2 cut(s) 189, 209
BsaI GGTCTC 1 cut(s) 337
BsaJI CCNNGG 2 cut(s) 384, 385
BsaWI WCCGGW 2 cut(s) 328, 391
BsaXI ACNNNNNCTCC 4 cut(s) 43, 73, 635, 665
Bsc4I CCNNNNNNNGG 2 cut(s) 68, 391
Bse3DI GCAATG 1 cut(s) 709
Bse8I GATNNNNATC 2 cut(s) 189, 209
BseAI TCCGGA 1 cut(s) 391
BseBI CCWGG 2 cut(s) 48, 617
BseDI CCNNGG 2 cut(s) 384, 385
BseGI GGATG 5 cut(s) 124, 166, 346, 400, 667
BseJI GATNNNNATC 2 cut(s) 189, 209
BseLI CCNNNNNNNGG 2 cut(s) 68, 391
BseMI GCAATG 1 cut(s) 709
BseMII CTCAG 1 cut(s) 291
BseRI GAGGAG 3 cut(s) 48, 51, 710
BseXI GCAGC 4 cut(s) 438, 444, 472, 480
BsgI GTGCAG 1 cut(s) 506
BshNI GGYRCC 1 cut(s) 619
BsiHKAI GWGCWC 1 cut(s) 408
BsiHKCI CYCGRG 1 cut(s) 385
BsiSI CCGG 3 cut(s) 329, 386, 392
BslI CCNNNNNNNGG 2 cut(s) 68, 391
BsmAI GTCTC 2 cut(s) 319, 337
Bso31I GGTCTC 1 cut(s) 337
BsoBI CYCGRG 1 cut(s) 385
Bsp1286I GDGCHC 2 cut(s) 139, 408
Bsp13I TCCGGA 1 cut(s) 391
Bsp143I GATC 8 cut(s) 90, 163, 184, 190, 204, 489, 631, 654
BspACI CCGC 1 cut(s) 356
BspCNI CTCAG 1 cut(s) 292
BspEI TCCGGA 1 cut(s) 391
BspLI GGNNCC 3 cut(s) 327, 390, 621
BspMAI CTGCAG 2 cut(s) 434, 462
BspPI GGATC 3 cut(s) 199, 639, 662
BspQI GCTCTTC 2 cut(s) 684, 804
BspT107I GGYRCC 1 cut(s) 619
BspTNI GGTCTC 1 cut(s) 337
BsrDI GCAATG 1 cut(s) 709
BssECI CCNNGG 2 cut(s) 384, 385
BssMI GATC 8 cut(s) 90, 163, 184, 190, 204, 489, 631, 654
Bst2UI CCWGG 2 cut(s) 48, 617
Bst4CI ACNGT 1 cut(s) 9
Bst6I CTCTTC 2 cut(s) 684, 804
BstC8I GCNNGC 3 cut(s) 445, 449, 473
BstDEI CTNAG 1 cut(s) 300
BstEII GGTNACC 1 cut(s) 565
BstF5I GGATG 5 cut(s) 124, 166, 346, 400, 667
BstH2I RGCGCY 1 cut(s) 686
BstHHI GCGC 2 cut(s) 685, 756
BstKTI GATC 8 cut(s) 93, 166, 187, 193, 207, 492, 634, 657
BstMAI GTCTC 2 cut(s) 319, 337
BstMBI GATC 8 cut(s) 90, 163, 184, 190, 204, 489, 631, 654
BstMWI GCNNNNNNNGC 7 cut(s) 25, 143, 380, 432, 457, 460, 691
BstNI CCWGG 2 cut(s) 48, 617
BstPI GGTNACC 1 cut(s) 565
BstSCI CCNGG 4 cut(s) 46, 384, 385, 615
BstSFI CTRYAG 3 cut(s) 430, 458, 806
BstV1I GCAGC 4 cut(s) 438, 444, 472, 480
BstV2I GAAGAC 1 cut(s) 231
BtsCI GGATG 5 cut(s) 124, 166, 346, 400, 667
Cac8I GCNNGC 3 cut(s) 445, 449, 473
CfoI GCGC 2 cut(s) 685, 756
Cfr13I GGNCC 2 cut(s) 177, 389
Cfr9I CCCGGG 1 cut(s) 385
CsiI ACCWGGT 1 cut(s) 46
Csp6I GTAC 1 cut(s) 51
CviAII CATG 5 cut(s) 14, 257, 305, 411, 529
CviJI RGCY 9 cut(s) 39, 72, 137, 326, 374, 383, 546, 673, 797
CviKI_1 RGCY 9 cut(s) 39, 72, 137, 326, 374, 383, 546, 673, 797
CviQI GTAC 1 cut(s) 51
DdeI CTNAG 1 cut(s) 300
DpnI GATC 8 cut(s) 92, 165, 186, 192, 206, 491, 633, 656
DpnII GATC 8 cut(s) 90, 163, 184, 190, 204, 489, 631, 654
Eam1104I CTCTTC 2 cut(s) 684, 804
EarI CTCTTC 2 cut(s) 684, 804
Eco24I GRGCYC 1 cut(s) 139
Eco31I GGTCTC 1 cut(s) 337
Eco47I GGWCC 2 cut(s) 177, 389
Eco47III AGCGCT 1 cut(s) 684
Eco88I CYCGRG 1 cut(s) 385
Eco91I GGTNACC 1 cut(s) 565
EcoO65I GGTNACC 1 cut(s) 565
EcoRII CCWGG 2 cut(s) 46, 615
EcoT38I GRGCYC 1 cut(s) 139
FaeI CATG 5 cut(s) 17, 260, 308, 414, 532
FatI CATG 5 cut(s) 13, 256, 304, 410, 528
FbaI TGATCA 1 cut(s) 184
Fnu4HI GCNGC 4 cut(s) 433, 452, 461, 469
FokI GGATG 5 cut(s) 131, 173, 353, 407, 674
FriOI GRGCYC 1 cut(s) 139
Fsp4HI GCNGC 4 cut(s) 433, 452, 461, 469
FspBI CTAG 2 cut(s) 513, 686
GlaI GCGC 2 cut(s) 684, 755
GluI GCNGC 4 cut(s) 433, 452, 461, 469
HaeII RGCGCY 1 cut(s) 686
HapII CCGG 3 cut(s) 329, 386, 392
HhaI GCGC 2 cut(s) 685, 756
Hin1II CATG 5 cut(s) 17, 260, 308, 414, 532
Hin6I GCGC 2 cut(s) 683, 754
HinP1I GCGC 2 cut(s) 683, 754
HinfI GANTC 5 cut(s) 22, 104, 516, 536, 713
HpaII CCGG 3 cut(s) 329, 386, 392
Hpy188I TCNGA 3 cut(s) 301, 550, 793
Hpy188III TCNNGA 4 cut(s) 77, 116, 188, 392
HpyAV CCTTC 2 cut(s) 261, 727
HpyCH4III ACNGT 1 cut(s) 9
HpyCH4IV ACGT 3 cut(s) 142, 229, 236
HpyCH4V TGCA 5 cut(s) 294, 432, 460, 487, 665
HpyF10VI GCNNNNNNNGC 7 cut(s) 25, 143, 380, 432, 457, 460, 691
HpyF3I CTNAG 1 cut(s) 300
HpySE526I ACGT 3 cut(s) 142, 229, 236
Hsp92II CATG 5 cut(s) 17, 260, 308, 414, 532
HspAI GCGC 2 cut(s) 683, 754
Kpn2I TCCGGA 1 cut(s) 391
Ksp22I TGATCA 1 cut(s) 184
Kzo9I GATC 8 cut(s) 90, 163, 184, 190, 204, 489, 631, 654
LguI GCTCTTC 2 cut(s) 684, 804
LmnI GCTCC 2 cut(s) 331, 371
Lsp1109I GCAGC 4 cut(s) 438, 444, 472, 480
LweI GCATC 3 cut(s) 275, 385, 652
MabI ACCWGGT 1 cut(s) 46
MaeI CTAG 2 cut(s) 513, 686
MaeII ACGT 3 cut(s) 142, 229, 236
MaeIII GTNAC 2 cut(s) 9, 565
MalI GATC 8 cut(s) 92, 165, 186, 192, 206, 491, 633, 656
MboI GATC 8 cut(s) 90, 163, 184, 190, 204, 489, 631, 654
MboII GAAGA 4 cut(s) 134, 231, 701, 791
MfeI CAATTG 1 cut(s) 559
MhlI GDGCHC 2 cut(s) 139, 408
MluCI AATT 7 cut(s) 80, 125, 154, 172, 559, 763, 787
MlyI GAGTC 2 cut(s) 510, 530
MmeI TCCRAC 1 cut(s) 310
MnlI CCTC 6 cut(s) 69, 72, 427, 596, 728, 731
MroI TCCGGA 1 cut(s) 391
MroXI GAANNNNTTC 1 cut(s) 798
MseI TTAA 1 cut(s) 351
MslI CAYNNNNRTG 2 cut(s) 309, 411
MspI CCGG 3 cut(s) 329, 386, 392
MspR9I CCNGG 4 cut(s) 48, 386, 387, 617
MunI CAATTG 1 cut(s) 559
MvaI CCWGG 2 cut(s) 48, 617
MwoI GCNNNNNNNGC 7 cut(s) 25, 143, 380, 432, 457, 460, 691
NciI CCSGG 2 cut(s) 386, 387
NdeII GATC 8 cut(s) 90, 163, 184, 190, 204, 489, 631, 654
NlaIII CATG 5 cut(s) 17, 260, 308, 414, 532
NlaIV GGNNCC 3 cut(s) 327, 390, 621
OliI CACNNNNGTG 1 cut(s) 411
PciSI GCTCTTC 2 cut(s) 684, 804
PdmI GAANNNNTTC 1 cut(s) 798
PfeI GAWTC 3 cut(s) 22, 104, 713
PkrI GCNGC 4 cut(s) 434, 453, 462, 470
PleI GAGTC 2 cut(s) 510, 530
PpsI GAGTC 2 cut(s) 510, 530
Psp1406I AACGTT 1 cut(s) 229
Psp6I CCWGG 2 cut(s) 46, 615
PspEI GGTNACC 1 cut(s) 565
PspGI CCWGG 2 cut(s) 46, 615
PspN4I GGNNCC 3 cut(s) 327, 390, 621
PspPI GGNCC 2 cut(s) 177, 389
PstI CTGCAG 2 cut(s) 434, 462
RsaI GTAC 1 cut(s) 52
RsaNI GTAC 1 cut(s) 51
RseI CAYNNNNRTG 2 cut(s) 309, 411
SapI GCTCTTC 2 cut(s) 684, 804
SaqAI TTAA 1 cut(s) 351
SatI GCNGC 4 cut(s) 433, 452, 461, 469
Sau3AI GATC 8 cut(s) 90, 163, 184, 190, 204, 489, 631, 654
Sau96I GGNCC 2 cut(s) 177, 389
SchI GAGTC 2 cut(s) 510, 530
ScrFI CCNGG 4 cut(s) 48, 386, 387, 617
SduI GDGCHC 2 cut(s) 139, 408
SexAI ACCWGGT 1 cut(s) 46
SfaNI GCATC 3 cut(s) 275, 385, 652
SfcI CTRYAG 3 cut(s) 430, 458, 806
SinI GGWCC 2 cut(s) 177, 389
SmaI CCCGGG 1 cut(s) 387
SmiMI CAYNNNNRTG 2 cut(s) 309, 411
SmlI CTYRAG 1 cut(s) 401
SmoI CTYRAG 1 cut(s) 401
Sse9I AATT 7 cut(s) 80, 125, 154, 172, 559, 763, 787
SsiI CCGC 1 cut(s) 356
SspI AATATT 1 cut(s) 603
SspMI CTAG 2 cut(s) 513, 686
StyD4I CCNGG 4 cut(s) 46, 384, 385, 615
TaaI ACNGT 1 cut(s) 9
TaiI ACGT 3 cut(s) 145, 232, 239
TaqI TCGA 3 cut(s) 203, 503, 519
TasI AATT 7 cut(s) 80, 125, 154, 172, 559, 763, 787
TfiI GAWTC 3 cut(s) 22, 104, 713
Tru1I TTAA 1 cut(s) 351
Tru9I TTAA 1 cut(s) 351
TseI GCWGC 4 cut(s) 432, 451, 460, 468
TspDTI ATGAA 3 cut(s) 135, 350, 522
TspMI CCCGGG 1 cut(s) 385
VpaK11BI GGWCC 2 cut(s) 177, 389
XapI RAATTY 1 cut(s) 80
XmaI CCCGGG 1 cut(s) 385
XmnI GAANNNNTTC 1 cut(s) 798
XspI CTAG 2 cut(s) 513, 686
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.