Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002522.1

Orthogroup ID

OG0019948

Physical Location & Seq

Genomic Coordinates Forward (+)

40445 .. 42396

Gene Structure 1952 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002522.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 432 bp

atggcatttctggaagctgcttgctcccatgttgagctcaaccatcacctccctgctcctcccatccagggcaccttatcttctagctttgttaatctacttaagaatgctagatgcttgggtgaagatgcctgtttgtttgcattgcttgtgcaatttcaagaattgctgaaaggggaatcagagggattgctgaaactctcatcagatacagctctgttagatgatgctgagttccgtaaatatgttgagctatatgcaaaggatgaggaggcatttttcagagattatgcagaatcacataagaaactctctgagcttgggtttactacaagttcctccaagattgttgcaaggggtagcaccatactggcacaaggtgcagttggagttgcaatttgtgctgctgttgtgatcctgggctacttctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000302 GO:0003674 GO:0003824 GO:0004130 GO:0004601 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0005773 GO:0005774 GO:0005777 GO:0005778 GO:0005911 GO:0006950 GO:0006979 GO:0008150 GO:0008152 GO:0009056 GO:0009506 GO:0009507 GO:0009526 GO:0009536 GO:0009636 GO:0009719 GO:0009725 GO:0009735 GO:0009941 GO:0009987 GO:0010033 GO:0016020 GO:0016209 GO:0016491 GO:0016684 GO:0016688 GO:0016999 GO:0017001 GO:0017144 GO:0030054 GO:0031090 GO:0031903 GO:0031967 GO:0031975 GO:0033554 GO:0034599 GO:0042221 GO:0042579 GO:0042737 GO:0042743 GO:0042744 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044248 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044437 GO:0044438 GO:0044439 GO:0044444 GO:0044446 GO:0044464 GO:0050896 GO:0051186 GO:0051187 GO:0051716 GO:0055044 GO:0055114 GO:0070887 GO:0072593 GO:0097237 GO:0098588 GO:0098754 GO:0098805 GO:0098869 GO:1901700 GO:1990748

KEGG Pathways

Metabolic & Signaling

ko00053 ko00480 map00053 map00480

Pfam Domains

Protein Families

peroxidase

Protein Analysis

143

Amino Acids

15.5

Weight (kDa)

5.14

Isoelectric Point (pI)

39.43

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019948)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr6g0251981 RchiOBHm_Chr6g0252121 RchiOBHm_Chr6g0252131
rosa_multiflora	Rmu_sc0002522.1_g000007
rosa_samantha	Rh6AG019500 Rh6BG015000
rosa_wichuraiana	Rw6G000060

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	71
AclWI	GGATC	1 cut(s)	409
AdeI	CACNNNGTG	1 cut(s)	380
AfiI	CCNNNNNNNGG	1 cut(s)	68
AflII	CTTAAG	1 cut(s)	101
AgsI	TTSAA	1 cut(s)	161
AjnI	CCWGG	2 cut(s)	66, 417
AluBI	AGCT	6 cut(s)	17, 37, 87, 215, 253, 319
AluI	AGCT	6 cut(s)	17, 37, 87, 215, 253, 319
Alw21I	GWGCWC	1 cut(s)	39
AlwI	GGATC	1 cut(s)	409
ApeKI	GCWGC	2 cut(s)	17, 404
AsuHPI	GGTGA	2 cut(s)	38, 134
BaeGI	GKGCMC	1 cut(s)	74
BanI	GGYRCC	1 cut(s)	71
BanII	GRGCYC	1 cut(s)	39
Bbv12I	GWGCWC	1 cut(s)	39
BbvI	GCAGC	2 cut(s)	4, 391
BccI	CCATC	2 cut(s)	51, 71
BciT130I	CCWGG	2 cut(s)	68, 419
BfaI	CTAG	3 cut(s)	84, 111, 430
BfrI	CTTAAG	1 cut(s)	101
BisI	GCNGC	2 cut(s)	18, 405
BlsI	GCNGC	2 cut(s)	19, 406
Bme1390I	CCNGG	2 cut(s)	68, 419
BmiI	GGNNCC	1 cut(s)	73
BmrFI	CCNGG	2 cut(s)	68, 419
BmsI	GCATC	3 cut(s)	104, 118, 217
BsaJI	CCNNGG	2 cut(s)	67, 418
Bsc4I	CCNNNNNNNGG	1 cut(s)	68
Bse1I	ACTGG	1 cut(s)	375
Bse3DI	GCAATG	1 cut(s)	143
BseBI	CCWGG	2 cut(s)	68, 419
BseDI	CCNNGG	2 cut(s)	67, 418
BseGI	GGATG	2 cut(s)	63, 271
BseLI	CCNNNNNNNGG	1 cut(s)	68
BseMI	GCAATG	1 cut(s)	143
BseMII	CTCAG	2 cut(s)	222, 306
BseNI	ACTGG	1 cut(s)	375
BseRI	GAGGAG	2 cut(s)	48, 284
BseSI	GKGCMC	1 cut(s)	74
BseXI	GCAGC	2 cut(s)	4, 391
BsgI	GTGCAG	1 cut(s)	402
BshNI	GGYRCC	1 cut(s)	71
BsiHKAI	GWGCWC	1 cut(s)	39
BslI	CCNNNNNNNGG	1 cut(s)	68
BsmI	GAATGC	1 cut(s)	112
Bsp1286I	GDGCHC	2 cut(s)	39, 74
Bsp143I	GATC	1 cut(s)	414
BspCNI	CTCAG	2 cut(s)	223, 307
BspLI	GGNNCC	1 cut(s)	73
BspPI	GGATC	1 cut(s)	409
BspT107I	GGYRCC	1 cut(s)	71
BspTI	CTTAAG	1 cut(s)	101
BsrDI	GCAATG	1 cut(s)	143
BsrI	ACTGG	1 cut(s)	375
BssECI	CCNNGG	2 cut(s)	67, 418
BssMI	GATC	1 cut(s)	414
Bst2UI	CCWGG	2 cut(s)	68, 419
BstAFI	CTTAAG	1 cut(s)	101
BstAPI	GCANNNNNTGC	2 cut(s)	380, 401
BstC8I	GCNNGC	1 cut(s)	22
BstDEI	CTNAG	2 cut(s)	231, 315
BstF5I	GGATG	2 cut(s)	63, 271
BstKTI	GATC	1 cut(s)	417
BstMBI	GATC	1 cut(s)	414
BstMWI	GCNNNNNNNGC	2 cut(s)	380, 401
BstNI	CCWGG	2 cut(s)	68, 419
BstSCI	CCNGG	2 cut(s)	66, 417
BstSLI	GKGCMC	1 cut(s)	74
BstV1I	GCAGC	2 cut(s)	4, 391
BtsCI	GGATG	2 cut(s)	63, 271
Cac8I	GCNNGC	1 cut(s)	22
CviAII	CATG	1 cut(s)	29
CviJI	RGCY	7 cut(s)	17, 37, 87, 215, 253, 319, 423
CviKI_1	RGCY	7 cut(s)	17, 37, 87, 215, 253, 319, 423
DdeI	CTNAG	2 cut(s)	231, 315
DpnI	GATC	1 cut(s)	416
DpnII	GATC	1 cut(s)	414
DraIII	CACNNNGTG	1 cut(s)	380
Ecl136II	GAGCTC	1 cut(s)	37
Eco24I	GRGCYC	1 cut(s)	39
Eco53kI	GAGCTC	1 cut(s)	37
EcoICRI	GAGCTC	1 cut(s)	37
EcoRII	CCWGG	2 cut(s)	66, 417
EcoT38I	GRGCYC	1 cut(s)	39
FaeI	CATG	1 cut(s)	32
FaiI	YATR	7 cut(s)	30, 246, 256, 258, 291, 303, 368
FatI	CATG	1 cut(s)	28
Fnu4HI	GCNGC	2 cut(s)	18, 405
FokI	GGATG	2 cut(s)	50, 278
FriOI	GRGCYC	1 cut(s)	39
Fsp4HI	GCNGC	2 cut(s)	18, 405
FspBI	CTAG	3 cut(s)	84, 111, 430
GluI	GCNGC	2 cut(s)	18, 405
Hin1II	CATG	1 cut(s)	32
HinfI	GANTC	2 cut(s)	179, 296
HphI	GGTGA	2 cut(s)	38, 134
Hpy166II	GTNNAC	1 cut(s)	327
Hpy188I	TCNGA	4 cut(s)	184, 208, 284, 316
Hpy188III	TCNNGA	2 cut(s)	11, 161
Hpy8I	GTNNAC	1 cut(s)	327
HpyCH4V	TGCA	7 cut(s)	143, 154, 260, 293, 353, 383, 395
HpyF10VI	GCNNNNNNNGC	2 cut(s)	380, 401
HpyF3I	CTNAG	2 cut(s)	231, 315
Hsp92II	CATG	1 cut(s)	32
Kzo9I	GATC	1 cut(s)	414
LmnI	GCTCC	2 cut(s)	29, 61
LpnPI	CCDG	6 cut(s)	53, 66, 80, 145, 356, 404
Lsp1109I	GCAGC	2 cut(s)	4, 391
LweI	GCATC	3 cut(s)	104, 118, 217
MaeI	CTAG	3 cut(s)	84, 111, 430
MalI	GATC	1 cut(s)	416
MboI	GATC	1 cut(s)	414
MboII	GAAGA	2 cut(s)	72, 137
MhlI	GDGCHC	2 cut(s)	39, 74
MluCI	AATT	3 cut(s)	155, 164, 396
MmeI	TCCRAC	1 cut(s)	367
MnlI	CCTC	6 cut(s)	59, 69, 178, 262, 265, 349
MseI	TTAA	2 cut(s)	93, 102
MspCI	CTTAAG	1 cut(s)	101
MspR9I	CCNGG	2 cut(s)	68, 419
Mva1269I	GAATGC	1 cut(s)	112
MvaI	CCWGG	2 cut(s)	68, 419
MwoI	GCNNNNNNNGC	2 cut(s)	380, 401
NdeII	GATC	1 cut(s)	414
NlaIII	CATG	1 cut(s)	32
NlaIV	GGNNCC	1 cut(s)	73
PctI	GAATGC	1 cut(s)	112
PfeI	GAWTC	2 cut(s)	179, 296
PkrI	GCNGC	2 cut(s)	19, 406
Psp124BI	GAGCTC	1 cut(s)	39
Psp6I	CCWGG	2 cut(s)	66, 417
PspGI	CCWGG	2 cut(s)	66, 417
PspN4I	GGNNCC	1 cut(s)	73
SacI	GAGCTC	1 cut(s)	39
SaqAI	TTAA	2 cut(s)	93, 102
SatI	GCNGC	2 cut(s)	18, 405
Sau3AI	GATC	1 cut(s)	414
ScrFI	CCNGG	2 cut(s)	68, 419
SduI	GDGCHC	2 cut(s)	39, 74
SetI	ASST	9 cut(s)	19, 39, 51, 77, 89, 217, 255, 321, 382
SfaNI	GCATC	3 cut(s)	104, 118, 217
SmlI	CTYRAG	1 cut(s)	101
SmoI	CTYRAG	1 cut(s)	101
Sse9I	AATT	3 cut(s)	155, 164, 396
SspMI	CTAG	3 cut(s)	84, 111, 430
SstI	GAGCTC	1 cut(s)	39
StyD4I	CCNGG	2 cut(s)	66, 417
TasI	AATT	3 cut(s)	155, 164, 396
TfiI	GAWTC	2 cut(s)	179, 296
Tru1I	TTAA	2 cut(s)	93, 102
Tru9I	TTAA	2 cut(s)	93, 102
TseI	GCWGC	2 cut(s)	17, 404
TspGWI	ACGGA	1 cut(s)	227
Vha464I	CTTAAG	1 cut(s)	101
XspI	CTAG	3 cut(s)	84, 111, 430

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.