Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002565.1

Orthogroup ID

OG0017115

Physical Location & Seq

Genomic Coordinates Reverse (-)

3862 .. 5433

Gene Structure 1572 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002565.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1572 bp

atgtgtagccaaaccgagactcaaagctcaattctggaagagatggaattcttagtactattgctttctttgttcctgagtttagtttcatgtgcaagttctgatccaaccactgaaactctcaggctgtgcatgacaactcaactcggtgactacaccgaaacgtctcaaatcatccacacctcaaactcatcttcgtattcatctatcttgaaatcctcacaacaaaatcctagatggctaaactccacatcaaagcctctcctcattctcacacctttcaacgagtccgaaatccgagcagctgtgctttgcagcagaaaacgtggcctacaaattagggtcagaagtggaggccatgactatgaagggctctcatatctctgcaagacgccattcatcatcattgacatgatcaacttcaagtccattgatgtcaaccttgctgatgaaacagcttgggttcagtcaggagctacgctaggtgagctttactatagcattgggaagaaaagtgacgtccatggattcccagctgggatttgtccaactgttggaattggtggtcattttagtggtggtggatttgggaccttgattaggaaacatggcctagcagctgaccatgtcatagatgctattttaattgatgctaatgggaaaatcatgaacagaaaaacaatgggggaggatctgttttgggccattagaggaggtggaggagcaagttttgggatcatagtttcatggaagatcaaattggttcaggtcccaaaagttgtgactggttttacagttaacaagttaatatcacaaggtggaagtagccttgtgaataggtggcagtacattgcagacaagttccatgaggatcttttcatgagagtcatccttcagaatgttgggagtggaaatcagaaacaagtccaagccgctttcaattctttgtttctaggagggattgagacactaatgccattgatgaaacagagctttccagagttgggtttggcggcaaaagactgcattgaaatgagttgggtccaatctgctcagtactttgctgggtacaaaaaagagcagcctttggaggtcttgttgtctagggaggcactctataagagcaatttcaaggccaaatccgactttgtaataaaccctattccagaaatcgggctacgagggatttgggaaaggttcatgctagaagaactagctttcatgatactggatccctatggtggaaagatggctgagatttcggaattcgaaattccatttcctcataggaaggggaatctgtacaacatacagtacattgtgaagtgggatgtgaatgaggtcagtgaagccaacaagcatatgaattggatgaatatgctttatgggtttatgaagccctatgtttcaaattctccaaggggtgcctacatcaattacaaggatcttcagttggggaccaacaacaaaggcactaacacgagctacatagaagcgagtagttgggggagaaagtacttcaaaaacttgatcttcgcgagccaaccaactcatccacactcgcgtccttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0005575 GO:0005618 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0008150 GO:0009505 GO:0009719 GO:0009725 GO:0009753 GO:0010033 GO:0030312 GO:0042221 GO:0044424 GO:0044444 GO:0044464 GO:0050896 GO:0071944 GO:1901700

KEGG Pathways

Metabolic & Signaling

ko00940 ko01100 ko01110 map00940 map01100 map01110

Pfam Domains

Protein Families

BBE FAD_binding_4

Protein Analysis

523

Amino Acids

58.46

Weight (kDa)

8.47

Isoelectric Point (pI)

39.3

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017115)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G20860
fragaria_vesca	FvH4_3g10830
malus_domestica	MD10G1247300.v1.1
prunus_persica	Prupe.4G096000_v2.0.a1 Prupe.4G096100_v2.0.a1
pyrus_communis	pycom05g25170 pycom10g20520
rosa_chinensis	RchiOBHm_Chr5g0017541
rosa_laevigata	RLG00000032297
rosa_multiflora	Rmu_sc0002565.1_g000003
rosa_roxburghii	Rroxscaffold_1G00059900
rosa_rugosa	Rorug05G0036800
rosa_wichuraiana	Rw5G011300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	522
AccB1I	GGYRCC	1 cut(s)	1424
AccB7I	CCANNNNNTGG	1 cut(s)	554
AccII	CGCG	2 cut(s)	1538, 1564
AciI	CCGC	2 cut(s)	933, 1013
AclWI	GGATC	7 cut(s)	98, 699, 743, 879, 1226, 1239, 1452
AcsI	RAATTY	4 cut(s)	47, 1265, 1272, 1411
AcuI	CTGAAG	2 cut(s)	878, 1433
AcyI	GRCGYC	2 cut(s)	392, 519
AdeI	CACNNNGTG	1 cut(s)	818
AfaI	GTAC	7 cut(s)	57, 848, 1058, 1070, 1304, 1316, 1517
AfiI	CCNNNNNNNGG	5 cut(s)	554, 600, 1004, 1172, 1241
AgsI	TTSAA	8 cut(s)	214, 283, 424, 940, 1031, 1132, 1410, 1522
AjuI	GAANNNNNNNTTGG	2 cut(s)	743, 775
Alw26I	GTCTC	3 cut(s)	11, 171, 959
AlwI	GGATC	7 cut(s)	98, 699, 743, 879, 1226, 1239, 1452
AoxI	GGCC	5 cut(s)	328, 355, 610, 702, 1134
ApeKI	GCWGC	4 cut(s)	302, 315, 617, 1081
ApoI	RAATTY	4 cut(s)	47, 1265, 1272, 1411
AspS9I	GGNCC	5 cut(s)	591, 702, 769, 1042, 1458
AsuHPI	GGTGA	2 cut(s)	161, 497
AsuII	TTCGAA	1 cut(s)	1269
AvaII	GGWCC	4 cut(s)	591, 769, 1042, 1458
BamHI	GGATCC	1 cut(s)	1231
BanI	GGYRCC	1 cut(s)	1424
BanII	GRGCYC	1 cut(s)	375
BauI	CACGAG	1 cut(s)	1480
BbvI	GCAGC	4 cut(s)	314, 327, 629, 1093
BccI	CCATC	3 cut(s)	37, 231, 1243
BclI	TGATCA	1 cut(s)	414
BcoDI	GTCTC	3 cut(s)	11, 171, 959
BfaI	CTAG	7 cut(s)	234, 482, 614, 953, 1104, 1205, 1214
BfmI	CTRYAG	1 cut(s)	496
BisI	GCNGC	6 cut(s)	303, 316, 618, 933, 1014, 1082
BlsI	GCNGC	6 cut(s)	304, 317, 619, 934, 1015, 1083
BmcAI	AGTACT	3 cut(s)	57, 1058, 1517
Bme18I	GGWCC	4 cut(s)	591, 769, 1042, 1458
BmgT120I	GGNCC	5 cut(s)	591, 702, 769, 1042, 1458
BmiI	GGNNCC	6 cut(s)	592, 771, 1043, 1233, 1426, 1459
BmsI	GCATC	2 cut(s)	625, 640
Bpu14I	TTCGAA	1 cut(s)	1269
BsaHI	GRCGYC	2 cut(s)	392, 519
BsaJI	CCNNGG	2 cut(s)	523, 1418
BsaXI	ACNNNNNCTCC	4 cut(s)	680, 710, 1082, 1112
Bsc4I	CCNNNNNNNGG	5 cut(s)	554, 600, 1004, 1172, 1241
Bse1I	ACTGG	2 cut(s)	790, 1233
Bse3DI	GCAATG	1 cut(s)	849
BseDI	CCNNGG	2 cut(s)	523, 1418
BseGI	GGATG	5 cut(s)	174, 888, 1336, 1377, 1552
BseLI	CCNNNNNNNGG	5 cut(s)	554, 600, 1004, 1172, 1241
BseMI	GCAATG	1 cut(s)	849
BseMII	CTCAG	4 cut(s)	68, 136, 1067, 1245
BseNI	ACTGG	2 cut(s)	790, 1233
BseRI	GAGGAG	3 cut(s)	254, 726, 735
BseXI	GCAGC	4 cut(s)	314, 327, 629, 1093
BseYI	CCCAGC	3 cut(s)	532, 536, 1064
Bsh1236I	CGCG	2 cut(s)	1538, 1564
BshFI	GGCC	5 cut(s)	330, 357, 612, 704, 1136
BshNI	GGYRCC	1 cut(s)	1424
BslFI	GGGAC	3 cut(s)	604, 755, 1471
BslI	CCNNNNNNNGG	5 cut(s)	554, 600, 1004, 1172, 1241
BsmAI	GTCTC	3 cut(s)	11, 171, 959
BsmBI	CGTCTC	1 cut(s)	171
BsmFI	GGGAC	3 cut(s)	604, 755, 1471
BsnI	GGCC	5 cut(s)	330, 357, 612, 704, 1136
Bsp119I	TTCGAA	1 cut(s)	1269
Bsp1286I	GDGCHC	1 cut(s)	375
Bsp1407I	TGTACA	1 cut(s)	1302
Bsp143I	GATC	9 cut(s)	103, 414, 691, 735, 753, 871, 1231, 1444, 1530
Bsp19I	CCATGG	1 cut(s)	523
Bsp68I	TCGCGA	1 cut(s)	1538
BspACI	CCGC	2 cut(s)	933, 1013
BspANI	GGCC	5 cut(s)	330, 357, 612, 704, 1136
BspCNI	CTCAG	4 cut(s)	69, 135, 1066, 1246
BspFNI	CGCG	2 cut(s)	1538, 1564
BspHI	TCATGA	3 cut(s)	666, 879, 1221
BspLI	GGNNCC	6 cut(s)	592, 771, 1043, 1233, 1426, 1459
BspPI	GGATC	7 cut(s)	98, 699, 743, 879, 1226, 1239, 1452
BspT104I	TTCGAA	1 cut(s)	1269
BspT107I	GGYRCC	1 cut(s)	1424
BsrDI	GCAATG	1 cut(s)	849
BsrGI	TGTACA	1 cut(s)	1302
BsrI	ACTGG	2 cut(s)	790, 1233
BssECI	CCNNGG	2 cut(s)	523, 1418
BssMI	GATC	9 cut(s)	103, 414, 691, 735, 753, 871, 1231, 1444, 1530
BssNI	GRCGYC	2 cut(s)	392, 519
BssSI	CACGAG	1 cut(s)	1480
BssT1I	CCWWGG	2 cut(s)	523, 1418
Bst2BI	CACGAG	1 cut(s)	1480
Bst4CI	ACNGT	3 cut(s)	553, 796, 1314
Bst6I	CTCTTC	1 cut(s)	33
BstACI	GRCGYC	2 cut(s)	392, 519
BstAUI	TGTACA	1 cut(s)	1302
BstBI	TTCGAA	1 cut(s)	1269
BstC8I	GCNNGC	1 cut(s)	1540
BstDEI	CTNAG	5 cut(s)	52, 77, 122, 1053, 1254
BstDSI	CCRYGG	1 cut(s)	523
BstENI	CCTNNNNNAGG	1 cut(s)	598
BstF5I	GGATG	5 cut(s)	174, 888, 1336, 1377, 1552
BstFNI	CGCG	2 cut(s)	1538, 1564
BstKTI	GATC	9 cut(s)	106, 417, 694, 738, 756, 874, 1234, 1447, 1533
BstMAI	GTCTC	3 cut(s)	11, 171, 959
BstMBI	GATC	9 cut(s)	103, 414, 691, 735, 753, 871, 1231, 1444, 1530
BstMWI	GCNNNNNNNGC	1 cut(s)	487
BstSFI	CTRYAG	1 cut(s)	496
BstUI	CGCG	2 cut(s)	1538, 1564
BstV1I	GCAGC	4 cut(s)	314, 327, 629, 1093
BstX2I	RGATCY	4 cut(s)	691, 871, 1231, 1444
BstYI	RGATCY	4 cut(s)	691, 871, 1231, 1444
BsuRI	GGCC	5 cut(s)	330, 357, 612, 704, 1136
BtgI	CCRYGG	1 cut(s)	523
BtsCI	GGATG	5 cut(s)	174, 888, 1336, 1377, 1552
BtsIMutI	CAGTG	2 cut(s)	111, 1351
BtuMI	TCGCGA	1 cut(s)	1538
Cac8I	GCNNGC	1 cut(s)	1540
CciI	TCATGA	3 cut(s)	666, 879, 1221
Cfr13I	GGNCC	5 cut(s)	591, 702, 769, 1042, 1458
CseI	GACGC	2 cut(s)	400, 1553
Csp6I	GTAC	7 cut(s)	56, 847, 1057, 1069, 1303, 1315, 1516
CviQI	GTAC	7 cut(s)	56, 847, 1057, 1069, 1303, 1315, 1516
DdeI	CTNAG	5 cut(s)	52, 77, 122, 1053, 1254
DpnI	GATC	9 cut(s)	105, 416, 693, 737, 755, 873, 1233, 1446, 1532
DpnII	GATC	9 cut(s)	103, 414, 691, 735, 753, 871, 1231, 1444, 1530
DraIII	CACNNNGTG	1 cut(s)	818
Eam1104I	CTCTTC	1 cut(s)	33
EarI	CTCTTC	1 cut(s)	33
Eco130I	CCWWGG	2 cut(s)	523, 1418
Eco24I	GRGCYC	1 cut(s)	375
Eco47I	GGWCC	4 cut(s)	591, 769, 1042, 1458
Eco57I	CTGAAG	2 cut(s)	878, 1433
EcoNI	CCTNNNNNAGG	1 cut(s)	598
EcoO109I	RGGNCCY	2 cut(s)	591, 769
EcoRI	GAATTC	2 cut(s)	47, 1265
EcoT14I	CCWWGG	2 cut(s)	523, 1418
EcoT38I	GRGCYC	1 cut(s)	375
ErhI	CCWWGG	2 cut(s)	523, 1418
Esp3I	CGTCTC	1 cut(s)	171
FaqI	GGGAC	3 cut(s)	604, 755, 1471
FauNDI	CATATG	1 cut(s)	1362
FbaI	TGATCA	1 cut(s)	414
Fnu4HI	GCNGC	6 cut(s)	303, 316, 618, 933, 1014, 1082
FokI	GGATG	5 cut(s)	161, 875, 1343, 1384, 1539
FriOI	GRGCYC	1 cut(s)	375
Fsp4HI	GCNGC	6 cut(s)	303, 316, 618, 933, 1014, 1082
FspBI	CTAG	7 cut(s)	234, 482, 614, 953, 1104, 1205, 1214
GluI	GCNGC	6 cut(s)	303, 316, 618, 933, 1014, 1082
GsaI	CCCAGC	3 cut(s)	536, 540, 1068
HaeIII	GGCC	5 cut(s)	330, 357, 612, 704, 1136
HgaI	GACGC	2 cut(s)	400, 1553
Hin1I	GRCGYC	2 cut(s)	392, 519
HincII	GTYRAC	2 cut(s)	439, 799
HindII	GTYRAC	2 cut(s)	439, 799
HinfI	GANTC	5 cut(s)	19, 287, 528, 885, 1297
HpaI	GTTAAC	1 cut(s)	799
HphI	GGTGA	2 cut(s)	161, 497
Hpy166II	GTNNAC	2 cut(s)	439, 799
Hpy188I	TCNGA	8 cut(s)	103, 292, 299, 347, 897, 918, 1144, 1264
Hpy8I	GTNNAC	2 cut(s)	439, 799
HpyAV	CCTTC	3 cut(s)	362, 902, 1285
HpyCH4III	ACNGT	3 cut(s)	553, 796, 1314
HpyCH4IV	ACGT	3 cut(s)	164, 325, 519
HpyCH4V	TGCA	6 cut(s)	95, 132, 315, 387, 854, 1026
HpyF10VI	GCNNNNNNNGC	1 cut(s)	487
HpyF3I	CTNAG	5 cut(s)	52, 77, 122, 1053, 1254
HpySE526I	ACGT	3 cut(s)	164, 325, 519
Hsp92I	GRCGYC	2 cut(s)	392, 519
Ksp22I	TGATCA	1 cut(s)	414
KspAI	GTTAAC	1 cut(s)	799
Kzo9I	GATC	9 cut(s)	103, 414, 691, 735, 753, 871, 1231, 1444, 1530
LmnI	GCTCC	2 cut(s)	473, 722
Lsp1109I	GCAGC	4 cut(s)	314, 327, 629, 1093
LweI	GCATC	2 cut(s)	625, 640
MaeI	CTAG	7 cut(s)	234, 482, 614, 953, 1104, 1205, 1214
MaeII	ACGT	3 cut(s)	164, 325, 519
MaeIII	GTNAC	3 cut(s)	149, 515, 781
MalI	GATC	9 cut(s)	105, 416, 693, 737, 755, 873, 1233, 1446, 1532
MboI	GATC	9 cut(s)	103, 414, 691, 735, 753, 871, 1231, 1444, 1530
MboII	GAAGA	7 cut(s)	50, 186, 520, 763, 1220, 1439, 1525
MflI	RGATCY	4 cut(s)	691, 871, 1231, 1444
MhlI	GDGCHC	1 cut(s)	375
MlyI	GAGTC	3 cut(s)	13, 296, 894
MmeI	TCCRAC	4 cut(s)	131, 535, 572, 1167
MseI	TTAA	3 cut(s)	644, 798, 806
MslI	CAYNNNNRTG	4 cut(s)	363, 410, 573, 1031
MspA1I	CMGCKG	3 cut(s)	305, 536, 620
MvnI	CGCG	2 cut(s)	1538, 1564
MwoI	GCNNNNNNNGC	1 cut(s)	487
NcoI	CCATGG	1 cut(s)	523
NdeI	CATATG	1 cut(s)	1362
NdeII	GATC	9 cut(s)	103, 414, 691, 735, 753, 871, 1231, 1444, 1530
NlaIV	GGNNCC	6 cut(s)	592, 771, 1043, 1233, 1426, 1459
NmuCI	GTSAC	3 cut(s)	149, 515, 781
NruI	TCGCGA	1 cut(s)	1538
NspV	TTCGAA	1 cut(s)	1269
PagI	TCATGA	3 cut(s)	666, 879, 1221
PfeI	GAWTC	2 cut(s)	528, 1297
PflFI	GACNNNGTC	1 cut(s)	626
PflMI	CCANNNNNTGG	1 cut(s)	554
PkrI	GCNGC	6 cut(s)	304, 317, 619, 934, 1015, 1083
PleI	GAGTC	3 cut(s)	13, 295, 893
PpsI	GAGTC	3 cut(s)	13, 295, 893
PpuMI	RGGWCCY	2 cut(s)	591, 769
Psp5II	RGGWCCY	2 cut(s)	591, 769
PspFI	CCCAGC	3 cut(s)	532, 536, 1064
PspN4I	GGNNCC	6 cut(s)	592, 771, 1043, 1233, 1426, 1459
PspPI	GGNCC	5 cut(s)	591, 702, 769, 1042, 1458
PspPPI	RGGWCCY	2 cut(s)	591, 769
PsuI	RGATCY	4 cut(s)	691, 871, 1231, 1444
PsyI	GACNNNGTC	1 cut(s)	626
PvuII	CAGCTG	3 cut(s)	305, 536, 620
RruI	TCGCGA	1 cut(s)	1538
RsaI	GTAC	7 cut(s)	57, 848, 1058, 1070, 1304, 1316, 1517
RsaNI	GTAC	7 cut(s)	56, 847, 1057, 1069, 1303, 1315, 1516
RseI	CAYNNNNRTG	4 cut(s)	363, 410, 573, 1031
SaqAI	TTAA	3 cut(s)	644, 798, 806
SatI	GCNGC	6 cut(s)	303, 316, 618, 933, 1014, 1082
Sau3AI	GATC	9 cut(s)	103, 414, 691, 735, 753, 871, 1231, 1444, 1530
Sau96I	GGNCC	5 cut(s)	591, 702, 769, 1042, 1458
ScaI	AGTACT	3 cut(s)	57, 1058, 1517
SchI	GAGTC	3 cut(s)	13, 296, 894
SduI	GDGCHC	1 cut(s)	375
SfaNI	GCATC	2 cut(s)	625, 640
SfcI	CTRYAG	1 cut(s)	496
SfuI	TTCGAA	1 cut(s)	1269
SinI	GGWCC	4 cut(s)	591, 769, 1042, 1458
SmiMI	CAYNNNNRTG	4 cut(s)	363, 410, 573, 1031
SsiI	CCGC	2 cut(s)	933, 1013
SspMI	CTAG	7 cut(s)	234, 482, 614, 953, 1104, 1205, 1214
StyI	CCWWGG	2 cut(s)	523, 1418
TaaI	ACNGT	3 cut(s)	553, 796, 1314
TaiI	ACGT	3 cut(s)	167, 328, 522
TaqI	TCGA	1 cut(s)	1269
TatI	WGTACW	6 cut(s)	55, 846, 1056, 1302, 1314, 1515
TauI	GCSGC	2 cut(s)	935, 1016
TfiI	GAWTC	2 cut(s)	528, 1297
Tru1I	TTAA	3 cut(s)	644, 798, 806
Tru9I	TTAA	3 cut(s)	644, 798, 806
TscAI	CASTG	2 cut(s)	118, 1351
TseFI	GTSAC	3 cut(s)	149, 515, 781
TseI	GCWGC	4 cut(s)	302, 315, 617, 1081
Tsp45I	GTSAC	3 cut(s)	149, 515, 781
TspRI	CASTG	2 cut(s)	118, 1351
Tth111I	GACNNNGTC	1 cut(s)	626
Van91I	CCANNNNNTGG	1 cut(s)	554
VpaK11BI	GGWCC	4 cut(s)	591, 769, 1042, 1458
XagI	CCTNNNNNAGG	1 cut(s)	598
XapI	RAATTY	4 cut(s)	47, 1265, 1272, 1411
XspI	CTAG	7 cut(s)	234, 482, 614, 953, 1104, 1205, 1214
ZraI	GACGTC	1 cut(s)	520
ZrmI	AGTACT	3 cut(s)	57, 1058, 1517

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.