Rmu_sc0002979.1_g000006

Rhomboid protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002979.1
OG0016228
Physical Location & Seq
Forward (+)
19229 .. 21947
2719 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1401 bp
atgtcgtcgacgtcgattcccgagaagcgctactattttagcagagcgtttcaaacagatgtaagagaaccgaggcccggacgggaggaccgggttccggtcgtgtttgatctcatcaaggaaagcagactttgccatgatgatatataccacttcgacactactgaacagtcacgtactttgacagagttacaattgcatatcccagaatttctattactatatatacgatttggtgatgatgatgatccgagtgaatggtgcttcgaaatatatgaattgttcggttctaactatcatggtgtcattgatacggttatactggaaccctttggagctgttacgcacaagttcattcctgcaactagatcatcaattgagagtttgcagaaagtgggatttgatagtttggaacaagccactatcaaacagatatcgacatgtagtatatgtgaggatgaatttgcggatggcaatgttgatcaactgattactcctttgccttgcaaacaccatttccatgctgattgcatttctcagtggttggagataagtcacttgtgccccttgtgtcgatatgccttgcctactgtggaacatgaggtagttagtaggattgaggctgcagcatattcaggaagactgagaagttataacaagagctggttgagatggaagaaaaatattgggtattcacatgtgggcttgagttacgaaactgccattgcagggcaccattggaggattataacttcagctttttcccatataagtgttcttcatcttgttttcaatatgagcgcactttggagtcttggggtagtcgaaaacttgggctctatagggcttggtgtggagtattatctgcattacactctcgtcttggttgtattgtctggggtgctggttttgggaatatatcatatcttgatacagaaattcaagctggagtattttcggagagtgacggctgttgggtattcttgtgttgtttttgggtggatgacgattctttctgtgaagcaaccgacgtccaagttgcacctgtttggattgctttcgcttcccattagttttgcaccttttgagtctcttatttttacttcaatcattgttccacaagcaagttttataggccatttatctggaatcattgtgggatatgctattgcatggggtttaattcatgggatgaacaattactgggcagtttccatgttaggatggattgtgctggtttgtgccttcagtttaaagcgatctggtgcctatgatttcagttttcttgagattgagtccgttgctgattcttctttgccctctgtacggtttattgcatcaggaaatggtagaacattgcaaatgagtgcattgccagctgcaggtgttgagcttgtataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Rhomboid

Protein Analysis

466

Amino Acids

52.52

Weight (kDa)

6.04

Isoelectric Point (pI)

50.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-RING_2 PF13639 147 - 192 6.6e-13 Ring finger domain
zf-C3HC4_2 PF13923 148 - 191 4.6e-08 Zinc finger, C3HC4 type (RING finger)
zf-C3HC4 PF00097 148 - 191 1.9e-07 Zinc finger, C3HC4 type (RING finger)
zf-rbx1 PF12678 148 - 192 1.7e-06 RING-H2 zinc finger domain
zf-RING_11 PF17123 148 - 178 7.4e-07 RING-like zinc finger
Rhomboid PF01694 244 - 395 1.1e-22 Rhomboid domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016228)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G59520
fragaria_vesca FvH4_6g51270
malus_domestica MD10G1004100.v1.1
prunus_persica Prupe.8G006500_v2.0.a1
pyrus_communis pycom10g00330
rosa_chinensis RchiOBHm_Chr2g0172871
rosa_laevigata RLG00000022133
rosa_multiflora Rmu_sc0002979.1_g000006
rosa_roxburghii Rroxscaffold_2G00079470
rosa_rugosa Rorug02G0562900
rosa_samantha Rh2AG639800 Rh2BG653200 Rh2CG619000 Rh2DG666900
rosa_wichuraiana Rw2G052820

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 654, 749
AarI CACCTGC 1 cut(s) 1373
AatII GACGTC 2 cut(s) 14, 1034
Acc36I ACCTGC 1 cut(s) 1373
AccB1I GGYRCC 2 cut(s) 732, 1265
AccI GTMKAC 1 cut(s) 8
AciI CCGC 1 cut(s) 467
AclWI GGATC 1 cut(s) 242
AcsI RAATTY 3 cut(s) 209, 461, 938
AcuI CTGAAG 2 cut(s) 738, 1231
AcyI GRCGYC 2 cut(s) 11, 1031
AfaI GTAC 2 cut(s) 178, 1326
AfeI AGCGCT 1 cut(s) 29
AfiI CCNNNNNNNGG 5 cut(s) 77, 97, 729, 1326, 1382
AflIII ACRYGT 2 cut(s) 440, 697
AgsI TTSAA 4 cut(s) 53, 793, 943, 1107
AluBI AGCT 6 cut(s) 338, 663, 758, 946, 1379, 1393
AluI AGCT 6 cut(s) 338, 663, 758, 946, 1379, 1393
Alw26I GTCTC 1 cut(s) 1095
AlwI GGATC 1 cut(s) 242
Ama87I CYCGRG 1 cut(s) 20
Aor51HI AGCGCT 1 cut(s) 29
AoxI GGCC 2 cut(s) 74, 1135
ApeKI GCWGC 3 cut(s) 623, 626, 1379
ApoI RAATTY 3 cut(s) 209, 461, 938
AspLEI GCGC 2 cut(s) 30, 803
AspS9I GGNCC 2 cut(s) 75, 88
AsuC2I CCSGG 2 cut(s) 78, 92
AsuHPI GGTGA 1 cut(s) 248
AsuII TTCGAA 1 cut(s) 267
AvaI CYCGRG 1 cut(s) 20
AvaII GGWCC 1 cut(s) 88
BaeGI GKGCMC 2 cut(s) 566, 735
BanI GGYRCC 2 cut(s) 732, 1265
BanII GRGCYC 1 cut(s) 839
BbsI GAAGAC 1 cut(s) 646
BbvI GCAGC 3 cut(s) 610, 638, 1366
BccI CCATC 3 cut(s) 464, 666, 1218
BceAI ACGGC 1 cut(s) 984
BclI TGATCA 1 cut(s) 481
BcnI CCSGG 2 cut(s) 78, 92
BcoDI GTCTC 1 cut(s) 1095
BfaI CTAG 1 cut(s) 366
BfmI CTRYAG 3 cut(s) 624, 840, 1380
BfoI RGCGCY 1 cut(s) 31
BfuAI ACCTGC 1 cut(s) 1373
BisI GCNGC 3 cut(s) 624, 627, 1380
BlsI GCNGC 3 cut(s) 625, 628, 1381
Bme1390I CCNGG 2 cut(s) 78, 92
Bme18I GGWCC 1 cut(s) 88
BmeT110I CYCGRG 1 cut(s) 20
BmgT120I GGNCC 2 cut(s) 75, 88
BmiI GGNNCC 4 cut(s) 96, 327, 734, 1267
BmrFI CCNGG 2 cut(s) 78, 92
BmrI ACTGGG 1 cut(s) 1213
BmsI GCATC 1 cut(s) 1346
BmuI ACTGGG 1 cut(s) 1213
BpiI GAAGAC 1 cut(s) 646
BpmI CTGGAG 1 cut(s) 968
Bpu14I TTCGAA 1 cut(s) 267
BpuEI CTTGAG 2 cut(s) 727, 1307
BpuMI CCSGG 2 cut(s) 78, 92
BsaAI YACGTR 1 cut(s) 176
BsaBI GATNNNNATC 1 cut(s) 246
BsaHI GRCGYC 2 cut(s) 11, 1031
BsaJI CCNNGG 1 cut(s) 71
BsaWI WCCGGW 1 cut(s) 97
Bsc4I CCNNNNNNNGG 5 cut(s) 77, 97, 729, 1326, 1382
Bse1I ACTGG 2 cut(s) 327, 1208
Bse3DI GCAATG 4 cut(s) 481, 723, 1355, 1370
Bse8I GATNNNNATC 1 cut(s) 246
BseDI CCNNGG 1 cut(s) 71
BseGI GGATG 5 cut(s) 463, 475, 1008, 1197, 1229
BseJI GATNNNNATC 1 cut(s) 246
BseLI CCNNNNNNNGG 5 cut(s) 77, 97, 729, 1326, 1382
BseMI GCAATG 4 cut(s) 481, 723, 1355, 1370
BseMII CTCAG 2 cut(s) 551, 635
BseNI ACTGG 2 cut(s) 327, 1208
BseSI GKGCMC 2 cut(s) 566, 735
BseXI GCAGC 3 cut(s) 610, 638, 1366
Bsh1285I CGRYCG 1 cut(s) 102
BshFI GGCC 2 cut(s) 76, 1137
BshNI GGYRCC 2 cut(s) 732, 1265
BsiEI CGRYCG 1 cut(s) 102
BsiHKCI CYCGRG 1 cut(s) 20
BsiSI CCGG 3 cut(s) 78, 91, 98
BslI CCNNNNNNNGG 5 cut(s) 77, 97, 729, 1326, 1382
BsmAI GTCTC 1 cut(s) 1095
BsnI GGCC 2 cut(s) 76, 1137
BsoBI CYCGRG 1 cut(s) 20
Bsp119I TTCGAA 1 cut(s) 267
Bsp1286I GDGCHC 3 cut(s) 566, 735, 839
Bsp143I GATC 5 cut(s) 109, 247, 368, 481, 1259
BspACI CCGC 1 cut(s) 467
BspANI GGCC 2 cut(s) 76, 1137
BspCNI CTCAG 2 cut(s) 550, 636
BspLI GGNNCC 4 cut(s) 96, 327, 734, 1267
BspMAI CTGCAG 2 cut(s) 628, 1384
BspMI ACCTGC 1 cut(s) 1373
BspPI GGATC 1 cut(s) 242
BspT104I TTCGAA 1 cut(s) 267
BspT107I GGYRCC 2 cut(s) 732, 1265
BsrDI GCAATG 4 cut(s) 481, 723, 1355, 1370
BsrI ACTGG 2 cut(s) 327, 1208
BssECI CCNNGG 1 cut(s) 71
BssMI GATC 5 cut(s) 109, 247, 368, 481, 1259
BssNI GRCGYC 2 cut(s) 11, 1031
Bst4CI ACNGT 4 cut(s) 171, 316, 592, 1329
BstACI GRCGYC 2 cut(s) 11, 1031
BstAPI GCANNNNNTGC 1 cut(s) 132
BstBAI YACGTR 1 cut(s) 176
BstBI TTCGAA 1 cut(s) 267
BstC8I GCNNGC 1 cut(s) 1377
BstDEI CTNAG 2 cut(s) 537, 644
BstF5I GGATG 5 cut(s) 463, 475, 1008, 1197, 1229
BstH2I RGCGCY 1 cut(s) 31
BstHHI GCGC 2 cut(s) 30, 803
BstKTI GATC 5 cut(s) 112, 250, 371, 484, 1262
BstMAI GTCTC 1 cut(s) 1095
BstMBI GATC 5 cut(s) 109, 247, 368, 481, 1259
BstMCI CGRYCG 1 cut(s) 102
BstMWI GCNNNNNNNGC 2 cut(s) 132, 1376
BstNSI RCATGY 2 cut(s) 444, 701
BstSCI CCNGG 2 cut(s) 76, 90
BstSFI CTRYAG 3 cut(s) 624, 840, 1380
BstSLI GKGCMC 2 cut(s) 566, 735
BstV1I GCAGC 3 cut(s) 610, 638, 1366
BstV2I GAAGAC 1 cut(s) 646
BstXI CCANNNNNNTGG 1 cut(s) 1145
BsuRI GGCC 2 cut(s) 76, 1137
BtsCI GGATG 5 cut(s) 463, 475, 1008, 1197, 1229
BtsIMutI CAGTG 1 cut(s) 545
BveI ACCTGC 1 cut(s) 1373
Cac8I GCNNGC 1 cut(s) 1377
CfoI GCGC 2 cut(s) 30, 803
Cfr13I GGNCC 2 cut(s) 75, 88
Csp6I GTAC 2 cut(s) 177, 1325
CviAII CATG 9 cut(s) 137, 299, 441, 521, 599, 698, 1173, 1187, 1216
CviQI GTAC 2 cut(s) 177, 1325
DdeI CTNAG 2 cut(s) 537, 644
DpnI GATC 5 cut(s) 111, 249, 370, 483, 1261
DpnII GATC 5 cut(s) 109, 247, 368, 481, 1259
DraI TTTAAA 1 cut(s) 1254
Eco24I GRGCYC 1 cut(s) 839
Eco32I GATATC 1 cut(s) 435
Eco47I GGWCC 1 cut(s) 88
Eco47III AGCGCT 1 cut(s) 29
Eco57I CTGAAG 2 cut(s) 738, 1231
Eco88I CYCGRG 1 cut(s) 20
EcoRV GATATC 1 cut(s) 435
EcoT38I GRGCYC 1 cut(s) 839
FaeI CATG 9 cut(s) 140, 302, 444, 524, 602, 701, 1176, 1190, 1219
FatI CATG 9 cut(s) 136, 298, 440, 520, 598, 697, 1172, 1186, 1215
FbaI TGATCA 1 cut(s) 481
FblI GTMKAC 1 cut(s) 8
Fnu4HI GCNGC 3 cut(s) 624, 627, 1380
FokI GGATG 5 cut(s) 470, 482, 1015, 1204, 1236
FriOI GRGCYC 1 cut(s) 839
Fsp4HI GCNGC 3 cut(s) 624, 627, 1380
FspBI CTAG 1 cut(s) 366
GlaI GCGC 2 cut(s) 29, 802
GluI GCNGC 3 cut(s) 624, 627, 1380
GsuI CTGGAG 1 cut(s) 968
HaeII RGCGCY 1 cut(s) 31
HaeIII GGCC 2 cut(s) 76, 1137
HapII CCGG 3 cut(s) 78, 91, 98
HhaI GCGC 2 cut(s) 30, 803
Hin1I GRCGYC 2 cut(s) 11, 1031
Hin1II CATG 9 cut(s) 140, 302, 444, 524, 602, 701, 1176, 1190, 1219
Hin6I GCGC 2 cut(s) 28, 801
HinP1I GCGC 2 cut(s) 28, 801
HincII GTYRAC 1 cut(s) 9
HindII GTYRAC 1 cut(s) 9
HinfI GANTC 7 cut(s) 16, 811, 1009, 1088, 1149, 1295, 1307
HpaII CCGG 3 cut(s) 78, 91, 98
HphI GGTGA 1 cut(s) 248
Hpy166II GTNNAC 1 cut(s) 9
Hpy188I TCNGA 2 cut(s) 252, 960
Hpy188III TCNNGA 6 cut(s) 20, 636, 928, 1146, 1286, 1341
Hpy8I GTNNAC 1 cut(s) 9
Hpy99I CGWCG 4 cut(s) 10, 13, 16, 1033
HpyAV CCTTC 1 cut(s) 1255
HpyCH4III ACNGT 4 cut(s) 171, 316, 592, 1329
HpyCH4IV ACGT 3 cut(s) 11, 175, 1031
HpyF10VI GCNNNNNNNGC 2 cut(s) 132, 1376
HpyF3I CTNAG 2 cut(s) 537, 644
HpySE526I ACGT 3 cut(s) 11, 175, 1031
Hsp92I GRCGYC 2 cut(s) 11, 1031
Hsp92II CATG 9 cut(s) 140, 302, 444, 524, 602, 701, 1176, 1190, 1219
HspAI GCGC 2 cut(s) 28, 801
Ksp22I TGATCA 1 cut(s) 481
Kzo9I GATC 5 cut(s) 109, 247, 368, 481, 1259
LmnI GCTCC 1 cut(s) 335
Lsp1109I GCAGC 3 cut(s) 610, 638, 1366
LweI GCATC 1 cut(s) 1346
MaeI CTAG 1 cut(s) 366
MaeII ACGT 3 cut(s) 11, 175, 1031
MaeIII GTNAC 6 cut(s) 171, 189, 340, 554, 710, 964
MalI GATC 5 cut(s) 111, 249, 370, 483, 1261
MboI GATC 5 cut(s) 109, 247, 368, 481, 1259
MboII GAAGA 4 cut(s) 651, 688, 770, 1302
MfeI CAATTG 2 cut(s) 194, 375
MhlI GDGCHC 3 cut(s) 566, 735, 839
MluCI AATT 8 cut(s) 194, 209, 278, 375, 461, 938, 1182, 1198
MlyI GAGTC 3 cut(s) 820, 1097, 1304
MmeI TCCRAC 1 cut(s) 525
MnlI CCTC 7 cut(s) 66, 79, 448, 595, 613, 735, 1330
MseI TTAA 2 cut(s) 1181, 1253
MslI CAYNNNNRTG 2 cut(s) 519, 771
MspA1I CMGCKG 1 cut(s) 1379
MspI CCGG 3 cut(s) 78, 91, 98
MspR9I CCNGG 2 cut(s) 78, 92
MunI CAATTG 2 cut(s) 194, 375
MwoI GCNNNNNNNGC 2 cut(s) 132, 1376
NciI CCSGG 2 cut(s) 78, 92
NdeII GATC 5 cut(s) 109, 247, 368, 481, 1259
NlaIII CATG 9 cut(s) 140, 302, 444, 524, 602, 701, 1176, 1190, 1219
NlaIV GGNNCC 4 cut(s) 96, 327, 734, 1267
NmuCI GTSAC 3 cut(s) 171, 554, 964
NspI RCATGY 2 cut(s) 444, 701
NspV TTCGAA 1 cut(s) 267
PaqCI CACCTGC 1 cut(s) 1373
PciI ACATGT 2 cut(s) 440, 697
PcsI WCGNNNNNNNCGW 1 cut(s) 11
PfeI GAWTC 4 cut(s) 16, 1009, 1149, 1307
PkrI GCNGC 3 cut(s) 625, 628, 1381
PleI GAGTC 3 cut(s) 819, 1096, 1303
PpsI GAGTC 3 cut(s) 819, 1096, 1303
Ppu21I YACGTR 1 cut(s) 176
PscI ACATGT 2 cut(s) 440, 697
PsiI TTATAA 2 cut(s) 654, 749
PspN4I GGNNCC 4 cut(s) 96, 327, 734, 1267
PspPI GGNCC 2 cut(s) 75, 88
PstI CTGCAG 2 cut(s) 628, 1384
PvuII CAGCTG 1 cut(s) 1379
RsaI GTAC 2 cut(s) 178, 1326
RsaNI GTAC 2 cut(s) 177, 1325
RseI CAYNNNNRTG 2 cut(s) 519, 771
SalI GTCGAC 1 cut(s) 7
SaqAI TTAA 2 cut(s) 1181, 1253
SatI GCNGC 3 cut(s) 624, 627, 1380
Sau3AI GATC 5 cut(s) 109, 247, 368, 481, 1259
Sau96I GGNCC 2 cut(s) 75, 88
SchI GAGTC 3 cut(s) 820, 1097, 1304
ScrFI CCNGG 2 cut(s) 78, 92
SduI GDGCHC 3 cut(s) 566, 735, 839
SfaNI GCATC 1 cut(s) 1346
SfcI CTRYAG 3 cut(s) 624, 840, 1380
SfuI TTCGAA 1 cut(s) 267
SgrDI CGTCGACG 1 cut(s) 7
SinI GGWCC 1 cut(s) 88
SmiMI CAYNNNNRTG 2 cut(s) 519, 771
SmlI CTYRAG 2 cut(s) 706, 1286
SmoI CTYRAG 2 cut(s) 706, 1286
Sse9I AATT 8 cut(s) 194, 209, 278, 375, 461, 938, 1182, 1198
SsiI CCGC 1 cut(s) 467
SspI AATATT 1 cut(s) 685
SspMI CTAG 1 cut(s) 366
StyD4I CCNGG 2 cut(s) 76, 90
TaaI ACNGT 4 cut(s) 171, 316, 592, 1329
TaiI ACGT 3 cut(s) 14, 178, 1034
TaqI TCGA 7 cut(s) 8, 14, 156, 267, 437, 574, 825
TasI AATT 8 cut(s) 194, 209, 278, 375, 461, 938, 1182, 1198
TfiI GAWTC 4 cut(s) 16, 1009, 1149, 1307
Tru1I TTAA 2 cut(s) 1181, 1253
Tru9I TTAA 2 cut(s) 1181, 1253
TscAI CASTG 1 cut(s) 545
TseFI GTSAC 3 cut(s) 171, 554, 964
TseI GCWGC 3 cut(s) 623, 626, 1379
Tsp45I GTSAC 3 cut(s) 171, 554, 964
TspDTI ATGAA 6 cut(s) 291, 343, 474, 770, 1175, 1208
TspGWI ACGGA 1 cut(s) 1288
TspRI CASTG 1 cut(s) 545
VpaK11BI GGWCC 1 cut(s) 88
XapI RAATTY 3 cut(s) 209, 461, 938
XceI RCATGY 2 cut(s) 444, 701
XmiI GTMKAC 1 cut(s) 8
XspI CTAG 1 cut(s) 366
ZraI GACGTC 2 cut(s) 12, 1032
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.