Rmu_sc0003058.1_g000016

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003058.1
OG0010529
Physical Location & Seq
Reverse (-)
66894 .. 67370
477 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003058.1_g000016.1.cds

Sequence Viewer

Length: 477 bp
atgatccatctgcatttatatgtatgggatgattcggattatgcaccactcctggtcaaaaacaaagccgcagagcttttgtttgggaacatcaaagctgaaagagtctattcgtgctataaggaaaaaccacatgacggagaagttaagttcaaagacactgacacagaaactggtgcaagtgcaaaaccaacttcacaacctaaagctgctgagggaggagttctggtttcttgctcatcagctgtagacaaaaggagcttagaatgggagggaaaacttggtttccagaggaacatggacttctataggatttggttaattcttctgaaaactatgctgcagcaaagaacgaacagccttttgaaatttgtagtcaatgtaaatcccagtttggattgggagaatgggaggtttgaaatggtttctgtgcagatgccatgcttaagaactaagcgatctccagagcatatttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

158

Amino Acids

18.12

Weight (kDa)

8.39

Isoelectric Point (pI)

43.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 249
AciI CCGC 1 cut(s) 69
AcsI RAATTY 1 cut(s) 368
AfiI CCNNNNNNNGG 1 cut(s) 137
AflII CTTAAG 1 cut(s) 445
AgsI TTSAA 3 cut(s) 154, 367, 419
AjnI CCWGG 1 cut(s) 51
AluBI AGCT 5 cut(s) 76, 98, 209, 245, 261
AluI AGCT 5 cut(s) 76, 98, 209, 245, 261
AlwNI CAGNNNCTG 1 cut(s) 173
ApeKI GCWGC 3 cut(s) 209, 340, 343
ApoI RAATTY 1 cut(s) 368
BbvCI CCTCAGC 1 cut(s) 213
BbvI GCAGC 3 cut(s) 196, 327, 355
BccI CCATC 1 cut(s) 15
BciT130I CCWGG 1 cut(s) 53
BfmI CTRYAG 3 cut(s) 246, 307, 341
BfrI CTTAAG 1 cut(s) 445
BisI GCNGC 4 cut(s) 69, 210, 341, 344
BlsI GCNGC 4 cut(s) 70, 211, 342, 345
Bme1390I CCNGG 1 cut(s) 53
BmrFI CCNGG 1 cut(s) 53
BmrI ACTGGG 1 cut(s) 384
BmsI GCATC 1 cut(s) 426
BmuI ACTGGG 1 cut(s) 384
BpmI CTGGAG 1 cut(s) 447
Bpu10I CCTNAGC 1 cut(s) 213
BsaXI ACNNNNNCTCC 2 cut(s) 213, 243
Bsc4I CCNNNNNNNGG 1 cut(s) 137
Bse1I ACTGG 2 cut(s) 178, 390
BseBI CCWGG 1 cut(s) 53
BseGI GGATG 1 cut(s) 34
BseLI CCNNNNNNNGG 1 cut(s) 137
BseMII CTCAG 1 cut(s) 204
BseNI ACTGG 2 cut(s) 178, 390
BseRI GAGGAG 1 cut(s) 234
BseXI GCAGC 3 cut(s) 196, 327, 355
BsgI GTGCAG 1 cut(s) 452
BslI CCNNNNNNNGG 1 cut(s) 137
Bsp143I GATC 2 cut(s) 3, 458
BspACI CCGC 1 cut(s) 69
BspCNI CTCAG 1 cut(s) 205
BspMAI CTGCAG 1 cut(s) 345
BspTI CTTAAG 1 cut(s) 445
BsrI ACTGG 2 cut(s) 178, 390
BssMI GATC 2 cut(s) 3, 458
Bst2UI CCWGG 1 cut(s) 53
BstAFI CTTAAG 1 cut(s) 445
BstDEI CTNAG 3 cut(s) 213, 262, 453
BstF5I GGATG 1 cut(s) 34
BstKTI GATC 2 cut(s) 6, 461
BstMBI GATC 2 cut(s) 3, 458
BstNI CCWGG 1 cut(s) 53
BstSCI CCNGG 1 cut(s) 51
BstSFI CTRYAG 3 cut(s) 246, 307, 341
BstV1I GCAGC 3 cut(s) 196, 327, 355
BtsCI GGATG 1 cut(s) 34
BtsIMutI CAGTG 1 cut(s) 159
CaiI CAGNNNCTG 1 cut(s) 173
CviAII CATG 3 cut(s) 134, 298, 441
CviJI RGCY 7 cut(s) 68, 76, 98, 209, 245, 261, 360
CviKI_1 RGCY 7 cut(s) 68, 76, 98, 209, 245, 261, 360
DdeI CTNAG 3 cut(s) 213, 262, 453
DpnI GATC 2 cut(s) 5, 460
DpnII GATC 2 cut(s) 3, 458
EcoRII CCWGG 1 cut(s) 51
FaeI CATG 3 cut(s) 137, 301, 444
FatI CATG 3 cut(s) 133, 297, 440
FblI GTMKAC 1 cut(s) 249
Fnu4HI GCNGC 4 cut(s) 69, 210, 341, 344
FokI GGATG 1 cut(s) 41
Fsp4HI GCNGC 4 cut(s) 69, 210, 341, 344
GluI GCNGC 4 cut(s) 69, 210, 341, 344
GsuI CTGGAG 1 cut(s) 447
Hin1II CATG 3 cut(s) 137, 301, 444
HinfI GANTC 2 cut(s) 32, 105
Hpy166II GTNNAC 1 cut(s) 250
Hpy188I TCNGA 2 cut(s) 37, 330
Hpy188III TCNNGA 2 cut(s) 289, 464
Hpy8I GTNNAC 1 cut(s) 250
HpyCH4V TGCA 6 cut(s) 13, 44, 179, 185, 343, 433
HpyF3I CTNAG 3 cut(s) 213, 262, 453
Hsp92II CATG 3 cut(s) 137, 301, 444
Kzo9I GATC 2 cut(s) 3, 458
LmnI GCTCC 1 cut(s) 258
LpnPI CCDG 6 cut(s) 38, 65, 159, 212, 302, 403
Lsp1109I GCAGC 3 cut(s) 196, 327, 355
LweI GCATC 1 cut(s) 426
MalI GATC 2 cut(s) 5, 460
MboI GATC 2 cut(s) 3, 458
MboII GAAGA 1 cut(s) 317
MluCI AATT 2 cut(s) 321, 368
MlyI GAGTC 1 cut(s) 114
MnlI CCTC 5 cut(s) 208, 212, 265, 285, 405
MseI TTAA 4 cut(s) 147, 320, 446, 475
MslI CAYNNNNRTG 1 cut(s) 18
MspA1I CMGCKG 1 cut(s) 245
MspCI CTTAAG 1 cut(s) 445
MspR9I CCNGG 1 cut(s) 53
MvaI CCWGG 1 cut(s) 53
NdeII GATC 2 cut(s) 3, 458
NlaIII CATG 3 cut(s) 137, 301, 444
PfeI GAWTC 1 cut(s) 32
PkrI GCNGC 4 cut(s) 70, 211, 342, 345
PleI GAGTC 1 cut(s) 113
PpsI GAGTC 1 cut(s) 113
Psp6I CCWGG 1 cut(s) 51
PspGI CCWGG 1 cut(s) 51
PstI CTGCAG 1 cut(s) 345
PstNI CAGNNNCTG 1 cut(s) 173
PvuII CAGCTG 1 cut(s) 245
RseI CAYNNNNRTG 1 cut(s) 18
SaqAI TTAA 4 cut(s) 147, 320, 446, 475
SatI GCNGC 4 cut(s) 69, 210, 341, 344
Sau3AI GATC 2 cut(s) 3, 458
SchI GAGTC 1 cut(s) 114
ScrFI CCNGG 1 cut(s) 53
SetI ASST 7 cut(s) 78, 100, 205, 211, 247, 263, 416
SfaNI GCATC 1 cut(s) 426
SfcI CTRYAG 3 cut(s) 246, 307, 341
SmiMI CAYNNNNRTG 1 cut(s) 18
SmlI CTYRAG 1 cut(s) 445
SmoI CTYRAG 1 cut(s) 445
Sse9I AATT 2 cut(s) 321, 368
SsiI CCGC 1 cut(s) 69
StyD4I CCNGG 1 cut(s) 51
TasI AATT 2 cut(s) 321, 368
TauI GCSGC 1 cut(s) 71
TfiI GAWTC 1 cut(s) 32
Tru1I TTAA 4 cut(s) 147, 320, 446, 475
Tru9I TTAA 4 cut(s) 147, 320, 446, 475
TscAI CASTG 1 cut(s) 166
TseI GCWGC 3 cut(s) 209, 340, 343
TspGWI ACGGA 1 cut(s) 153
TspRI CASTG 1 cut(s) 166
Vha464I CTTAAG 1 cut(s) 445
XapI RAATTY 1 cut(s) 368
XmiI GTMKAC 1 cut(s) 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.