Rmu_sc0003382.1_g000029

Uncharacterized protein At4g22758-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003382.1
OG0020000
Physical Location & Seq
Forward (+)
127677 .. 129140
1464 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 651 bp
atgcagcagagacaaaacaaagaaaaggaactagccagcacccctggccttaaagcctctagctctgggaaccccaattatatcatccaaaaggcattcagtgatcaaagcaggagggtcatgcaggatgcagattcctttagcatgcaggatacagttcttagccaagagatcagcaaccatgttgcgttcacgctggatatgtgtaatctggatgaactcaaactcttgcatcaggtgtttgcagttcatgatcaatcagttcatggggcgttgccagaaggctgcatagccaacgtgatctcgttgacgactcttcaagacacgtgcagactatcgttgatttcgaggaatttcaagtcggcggcggactccgacgccgtttgggtcaagttctttccgcatgagaccaggttcttgatcatcattactgtgctgggtagtgccagccctatccgatttgtcgtcaaagaggagatgtttgtcgctgcggtcatcgataccgccttgaaatcctatgctcctaaaggtcgccttcctattctcggaactgatctcaatgagttcatgctctactgccccactgctagacctgatggtaatatctccatagtctcttttatcactttcgaatctcttcctgaattctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

216

Amino Acids

24.01

Weight (kDa)

5.52

Isoelectric Point (pI)

38.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7054 PF23156 136 - 196 1.8e-16 Domain of unknown function (DUF7054)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020000)

Species Orthologous Gene IDs
rosa_laevigata RLG00000006348 RLG00000009287 RLG00000011184
rosa_multiflora Rmu_sc0000058.1_g000008 Rmu_sc0003382.1_g000029 Rmu_sc0004790.1_g000002
rosa_samantha Rh7AG377000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 5 cut(s) 365, 368, 401, 491, 504
AcsI RAATTY 2 cut(s) 352, 644
AcvI CACGTG 1 cut(s) 327
AcyI GRCGYC 1 cut(s) 378
AfiI CCNNNNNNNGG 1 cut(s) 545
AflIII ACRYGT 1 cut(s) 324
AgsI TTSAA 3 cut(s) 320, 358, 511
AjnI CCWGG 2 cut(s) 43, 410
AluBI AGCT 1 cut(s) 63
AluI AGCT 1 cut(s) 63
Alw26I GTCTC 3 cut(s) 4, 401, 619
AoxI GGCC 1 cut(s) 46
ApeKI GCWGC 3 cut(s) 4, 285, 488
ApoI RAATTY 2 cut(s) 352, 644
Asp700I GAANNNNTTC 1 cut(s) 636
AsuII TTCGAA 1 cut(s) 630
BbrPI CACGTG 1 cut(s) 327
BbvI GCAGC 3 cut(s) 16, 272, 475
BccI CCATC 1 cut(s) 590
BceAI ACGGC 1 cut(s) 365
BciT130I CCWGG 2 cut(s) 45, 412
BciVI GTATCC 1 cut(s) 145
BclI TGATCA 3 cut(s) 103, 253, 420
BcoDI GTCTC 3 cut(s) 4, 401, 619
BfaI CTAG 3 cut(s) 32, 60, 588
BfuI GTATCC 1 cut(s) 145
BisI GCNGC 4 cut(s) 5, 286, 366, 489
BlsI GCNGC 4 cut(s) 6, 287, 367, 490
Bme1390I CCNGG 2 cut(s) 45, 412
BmiI GGNNCC 1 cut(s) 71
BmrFI CCNGG 2 cut(s) 45, 412
BmsI GCATC 2 cut(s) 118, 241
Bpu14I TTCGAA 1 cut(s) 630
Bsa29I ATCGAT 1 cut(s) 498
BsaAI YACGTR 1 cut(s) 327
BsaHI GRCGYC 1 cut(s) 378
BsaI GGTCTC 1 cut(s) 401
BsaJI CCNNGG 1 cut(s) 43
Bsc4I CCNNNNNNNGG 1 cut(s) 545
BseBI CCWGG 2 cut(s) 45, 412
BseCI ATCGAT 1 cut(s) 498
BseDI CCNNGG 1 cut(s) 43
BseGI GGATG 3 cut(s) 84, 133, 220
BseLI CCNNNNNNNGG 1 cut(s) 545
BseRI GAGGAG 1 cut(s) 488
BseXI GCAGC 3 cut(s) 16, 272, 475
BseYI CCCAGC 1 cut(s) 436
BsgI GTGCAG 1 cut(s) 349
BshFI GGCC 1 cut(s) 48
BshVI ATCGAT 1 cut(s) 498
BslI CCNNNNNNNGG 1 cut(s) 545
BsmAI GTCTC 3 cut(s) 4, 401, 619
BsmI GAATGC 1 cut(s) 95
BsnI GGCC 1 cut(s) 48
Bso31I GGTCTC 1 cut(s) 401
Bsp119I TTCGAA 1 cut(s) 630
Bsp143I GATC 6 cut(s) 103, 171, 253, 300, 420, 553
BspACI CCGC 5 cut(s) 365, 368, 401, 491, 504
BspANI GGCC 1 cut(s) 48
BspDI ATCGAT 1 cut(s) 498
BspHI TCATGA 1 cut(s) 250
BspLI GGNNCC 1 cut(s) 71
BspT104I TTCGAA 1 cut(s) 630
BspTNI GGTCTC 1 cut(s) 401
BssECI CCNNGG 1 cut(s) 43
BssMI GATC 6 cut(s) 103, 171, 253, 300, 420, 553
BssNI GRCGYC 1 cut(s) 378
Bst2UI CCWGG 2 cut(s) 45, 412
Bst4CI ACNGT 2 cut(s) 157, 433
Bst6I CTCTTC 2 cut(s) 321, 642
BstACI GRCGYC 1 cut(s) 378
BstBAI YACGTR 1 cut(s) 327
BstBI TTCGAA 1 cut(s) 630
BstC8I GCNNGC 3 cut(s) 37, 146, 448
BstDEI CTNAG 1 cut(s) 161
BstF5I GGATG 3 cut(s) 84, 133, 220
BstKTI GATC 6 cut(s) 106, 174, 256, 303, 423, 556
BstMAI GTCTC 3 cut(s) 4, 401, 619
BstMBI GATC 6 cut(s) 103, 171, 253, 300, 420, 553
BstMWI GCNNNNNNNGC 1 cut(s) 45
BstNI CCWGG 2 cut(s) 45, 412
BstNSI RCATGY 1 cut(s) 148
BstSCI CCNGG 2 cut(s) 43, 410
BstV1I GCAGC 3 cut(s) 16, 272, 475
Bsu15I ATCGAT 1 cut(s) 498
BsuI GTATCC 1 cut(s) 145
BsuRI GGCC 1 cut(s) 48
BsuTUI ATCGAT 1 cut(s) 498
BtsCI GGATG 3 cut(s) 84, 133, 220
BtsI GCAGTG 1 cut(s) 582
BtsIMutI CAGTG 2 cut(s) 106, 582
Cac8I GCNNGC 3 cut(s) 37, 146, 448
CciI TCATGA 1 cut(s) 250
ClaI ATCGAT 1 cut(s) 498
CseI GACGC 1 cut(s) 386
CsiI ACCWGGT 1 cut(s) 410
CviAII CATG 7 cut(s) 121, 145, 182, 251, 266, 404, 568
CviJI RGCY 8 cut(s) 35, 48, 56, 63, 165, 285, 293, 450
CviKI_1 RGCY 8 cut(s) 35, 48, 56, 63, 165, 285, 293, 450
DdeI CTNAG 1 cut(s) 161
DpnI GATC 6 cut(s) 105, 173, 255, 302, 422, 555
DpnII GATC 6 cut(s) 103, 171, 253, 300, 420, 553
Eam1104I CTCTTC 2 cut(s) 321, 642
EarI CTCTTC 2 cut(s) 321, 642
EciI GGCGGA 1 cut(s) 383
Eco31I GGTCTC 1 cut(s) 401
Eco72I CACGTG 1 cut(s) 327
EcoRI GAATTC 1 cut(s) 644
EcoRII CCWGG 2 cut(s) 43, 410
FaeI CATG 7 cut(s) 124, 148, 185, 254, 269, 407, 571
FalI AAGNNNNNCTT 2 cut(s) 519, 551
FatI CATG 7 cut(s) 120, 144, 181, 250, 265, 403, 567
FbaI TGATCA 3 cut(s) 103, 253, 420
Fnu4HI GCNGC 4 cut(s) 5, 286, 366, 489
FokI GGATG 3 cut(s) 71, 140, 227
Fsp4HI GCNGC 4 cut(s) 5, 286, 366, 489
FspBI CTAG 3 cut(s) 32, 60, 588
GluI GCNGC 4 cut(s) 5, 286, 366, 489
GsaI CCCAGC 1 cut(s) 440
HaeIII GGCC 1 cut(s) 48
HgaI GACGC 1 cut(s) 386
Hin1I GRCGYC 1 cut(s) 378
Hin1II CATG 7 cut(s) 124, 148, 185, 254, 269, 407, 571
HincII GTYRAC 1 cut(s) 309
HindII GTYRAC 1 cut(s) 309
HinfI GANTC 4 cut(s) 134, 313, 371, 632
Hpy166II GTNNAC 2 cut(s) 192, 309
Hpy188I TCNGA 3 cut(s) 376, 458, 548
Hpy188III TCNNGA 5 cut(s) 212, 251, 320, 418, 641
Hpy8I GTNNAC 2 cut(s) 192, 309
Hpy99I CGWCG 1 cut(s) 380
HpyAV CCTTC 2 cut(s) 275, 545
HpyCH4III ACNGT 2 cut(s) 157, 433
HpyCH4IV ACGT 2 cut(s) 297, 326
HpyCH4V TGCA 8 cut(s) 4, 124, 131, 148, 232, 245, 288, 330
HpyF10VI GCNNNNNNNGC 1 cut(s) 45
HpyF3I CTNAG 1 cut(s) 161
HpySE526I ACGT 2 cut(s) 297, 326
Hsp92I GRCGYC 1 cut(s) 378
Hsp92II CATG 7 cut(s) 124, 148, 185, 254, 269, 407, 571
Ksp22I TGATCA 3 cut(s) 103, 253, 420
Kzo9I GATC 6 cut(s) 103, 171, 253, 300, 420, 553
LmnI GCTCC 1 cut(s) 526
Lsp1109I GCAGC 3 cut(s) 16, 272, 475
LweI GCATC 2 cut(s) 118, 241
MabI ACCWGGT 1 cut(s) 410
MaeI CTAG 3 cut(s) 32, 60, 588
MaeII ACGT 2 cut(s) 297, 326
MalI GATC 6 cut(s) 105, 173, 255, 302, 422, 555
MboI GATC 6 cut(s) 103, 171, 253, 300, 420, 553
MboII GAAGA 2 cut(s) 308, 629
MluCI AATT 3 cut(s) 76, 352, 644
MlyI GAGTC 2 cut(s) 307, 365
MmeI TCCRAC 1 cut(s) 399
MnlI CCTC 4 cut(s) 67, 108, 342, 466
MroXI GAANNNNTTC 1 cut(s) 636
MseI TTAA 1 cut(s) 51
MslI CAYNNNNRTG 1 cut(s) 431
MspR9I CCNGG 2 cut(s) 45, 412
Mva1269I GAATGC 1 cut(s) 95
MvaI CCWGG 2 cut(s) 45, 412
MwoI GCNNNNNNNGC 1 cut(s) 45
NdeII GATC 6 cut(s) 103, 171, 253, 300, 420, 553
NlaIII CATG 7 cut(s) 124, 148, 185, 254, 269, 407, 571
NlaIV GGNNCC 1 cut(s) 71
NspI RCATGY 1 cut(s) 148
NspV TTCGAA 1 cut(s) 630
PaeI GCATGC 1 cut(s) 148
PagI TCATGA 1 cut(s) 250
PcsI WCGNNNNNNNCGW 1 cut(s) 344
PctI GAATGC 1 cut(s) 95
PdmI GAANNNNTTC 1 cut(s) 636
PfeI GAWTC 2 cut(s) 134, 632
PkrI GCNGC 4 cut(s) 6, 287, 367, 490
PleI GAGTC 2 cut(s) 307, 365
PmaCI CACGTG 1 cut(s) 327
PmlI CACGTG 1 cut(s) 327
PpsI GAGTC 2 cut(s) 307, 365
Ppu21I YACGTR 1 cut(s) 327
Psp6I CCWGG 2 cut(s) 43, 410
PspCI CACGTG 1 cut(s) 327
PspFI CCCAGC 1 cut(s) 436
PspGI CCWGG 2 cut(s) 43, 410
PspN4I GGNNCC 1 cut(s) 71
RseI CAYNNNNRTG 1 cut(s) 431
SaqAI TTAA 1 cut(s) 51
SatI GCNGC 4 cut(s) 5, 286, 366, 489
Sau3AI GATC 6 cut(s) 103, 171, 253, 300, 420, 553
SchI GAGTC 2 cut(s) 307, 365
ScrFI CCNGG 2 cut(s) 45, 412
SetI ASST 7 cut(s) 65, 240, 300, 329, 416, 532, 595
SexAI ACCWGGT 1 cut(s) 410
SfaNI GCATC 2 cut(s) 118, 241
SfuI TTCGAA 1 cut(s) 630
SmiMI CAYNNNNRTG 1 cut(s) 431
SphI GCATGC 1 cut(s) 148
Sse9I AATT 3 cut(s) 76, 352, 644
SsiI CCGC 5 cut(s) 365, 368, 401, 491, 504
SspMI CTAG 3 cut(s) 32, 60, 588
StyD4I CCNGG 2 cut(s) 43, 410
TaaI ACNGT 2 cut(s) 157, 433
TaiI ACGT 2 cut(s) 300, 329
TaqI TCGA 3 cut(s) 347, 498, 630
TasI AATT 3 cut(s) 76, 352, 644
TauI GCSGC 1 cut(s) 368
TfiI GAWTC 2 cut(s) 134, 632
Tru1I TTAA 1 cut(s) 51
Tru9I TTAA 1 cut(s) 51
TscAI CASTG 2 cut(s) 106, 589
TseI GCWGC 3 cut(s) 4, 285, 488
TspDTI ATGAA 4 cut(s) 231, 239, 254, 556
TspRI CASTG 2 cut(s) 106, 589
XapI RAATTY 2 cut(s) 352, 644
XceI RCATGY 1 cut(s) 148
XmnI GAANNNNTTC 1 cut(s) 636
XspI CTAG 3 cut(s) 32, 60, 588
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.