Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003722.1

Orthogroup ID

OG0019754

Physical Location & Seq

Genomic Coordinates Reverse (-)

14929 .. 16785

Gene Structure 1857 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003722.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 315 bp

atgcatcctcctatgttacccaacccatctggtgatggtttgcaattttaccaaaaaaggaagttggtcaggaataatgaaggaagtctctcttgcaatacaggtgcggatgatatgatgacggaggacgaaatcgagcatgaactagttgcagaagcagagactgcatgggcacagcgcgaatggtcaatccagcatgtgttgtttccatcaatgaggctcttttttaagccaccaaattctatggctacaaatggaacatttgttcgagttgcttcactagaaaagctgtacaggatttttgaaagatgctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0000228 GO:0000785 GO:0000790 GO:0000793 GO:0000794 GO:0000795 GO:0002200 GO:0002376 GO:0002377 GO:0002440 GO:0002520 GO:0002566 GO:0003006 GO:0003674 GO:0003676 GO:0003677 GO:0003697 GO:0003824 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005694 GO:0005712 GO:0006139 GO:0006259 GO:0006281 GO:0006298 GO:0006310 GO:0006312 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0007275 GO:0008150 GO:0008152 GO:0009555 GO:0009791 GO:0009845 GO:0009987 GO:0010154 GO:0016445 GO:0016446 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0022414 GO:0031974 GO:0031981 GO:0032300 GO:0032389 GO:0032501 GO:0032502 GO:0032991 GO:0033554 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044237 GO:0044238 GO:0044260 GO:0044422 GO:0044424 GO:0044427 GO:0044428 GO:0044446 GO:0044454 GO:0044464 GO:0046483 GO:0048229 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0050896 GO:0051716 GO:0061458 GO:0070013 GO:0071704 GO:0090304 GO:0090351 GO:0097159 GO:0099086 GO:1901360 GO:1901363 GO:1990391

KEGG Pathways

Metabolic & Signaling

ko01524 ko03430 ko03460 ko05200 ko05210 ko05213 ko05226 map01524 map03430 map03460 map05200 map05210 map05213 map05226

Pfam Domains

Protein Families

DNA_mis_repair HATPase_c_3 Mlh1_C

Protein Analysis

104

Amino Acids

11.99

Weight (kDa)

5.56

Isoelectric Point (pI)

33.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019754)

Species	Orthologous Gene IDs
malus_domestica	MD14G1034100.v1.1
pyrus_communis	pycom08g11520
rosa_multiflora	Rmu_sc0003722.1_g000005 Rmu_sc0039398.1_g000001
rosa_samantha	Rh7AG388500 Rh7AG388600 Rh7CG407800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	180
AciI	CCGC	1 cut(s)	107
AcsI	RAATTY	1 cut(s)	238
AfaI	GTAC	1 cut(s)	293
AgsI	TTSAA	1 cut(s)	305
AhlI	ACTAGT	1 cut(s)	145
AloI	GAACNNNNNNTCC	2 cut(s)	249, 281
AluBI	AGCT	1 cut(s)	289
AluI	AGCT	1 cut(s)	289
Alw26I	GTCTC	2 cut(s)	92, 155
AlwNI	CAGNNNCTG	1 cut(s)	164
ApoI	RAATTY	1 cut(s)	238
AspLEI	GCGC	1 cut(s)	180
AsuHPI	GGTGA	1 cut(s)	44
BaeGI	GKGCMC	1 cut(s)	175
BccI	CCATC	3 cut(s)	29, 34, 217
BcoDI	GTCTC	2 cut(s)	92, 155
BcuI	ACTAGT	1 cut(s)	145
BfaI	CTAG	2 cut(s)	146, 281
BmsI	GCATC	2 cut(s)	13, 299
BseGI	GGATG	2 cut(s)	4, 115
BseSI	GKGCMC	1 cut(s)	175
Bsh1236I	CGCG	1 cut(s)	180
BsmAI	GTCTC	2 cut(s)	92, 155
Bsp1286I	GDGCHC	1 cut(s)	175
Bsp1407I	TGTACA	1 cut(s)	291
BspACI	CCGC	1 cut(s)	107
BspFNI	CGCG	1 cut(s)	180
BsrGI	TGTACA	1 cut(s)	291
BstAPI	GCANNNNNTGC	1 cut(s)	164
BstAUI	TGTACA	1 cut(s)	291
BstF5I	GGATG	2 cut(s)	4, 115
BstFNI	CGCG	1 cut(s)	180
BstHHI	GCGC	1 cut(s)	180
BstMAI	GTCTC	2 cut(s)	92, 155
BstMWI	GCNNNNNNNGC	1 cut(s)	164
BstNSI	RCATGY	1 cut(s)	200
BstSLI	GKGCMC	1 cut(s)	175
BstUI	CGCG	1 cut(s)	180
BtsCI	GGATG	2 cut(s)	4, 115
CaiI	CAGNNNCTG	1 cut(s)	164
CfoI	GCGC	1 cut(s)	180
Csp6I	GTAC	1 cut(s)	292
CviAII	CATG	3 cut(s)	140, 168, 197
CviJI	RGCY	4 cut(s)	220, 232, 248, 289
CviKI_1	RGCY	4 cut(s)	220, 232, 248, 289
CviQI	GTAC	1 cut(s)	292
EcoT22I	ATGCAT	1 cut(s)	6
FaeI	CATG	3 cut(s)	143, 171, 200
FaiI	YATR	6 cut(s)	14, 116, 141, 169, 198, 245
FalI	AAGNNNNNCTT	2 cut(s)	76, 108
FatI	CATG	3 cut(s)	139, 167, 196
FokI	GGATG	1 cut(s)	122
FspBI	CTAG	2 cut(s)	146, 281
GlaI	GCGC	1 cut(s)	179
HhaI	GCGC	1 cut(s)	180
Hin1II	CATG	3 cut(s)	143, 171, 200
Hin6I	GCGC	1 cut(s)	178
HinP1I	GCGC	1 cut(s)	178
HphI	GGTGA	1 cut(s)	44
Hpy188III	TCNNGA	1 cut(s)	70
HpyAV	CCTTC	1 cut(s)	74
HpyCH4V	TGCA	5 cut(s)	4, 43, 96, 152, 167
HpyF10VI	GCNNNNNNNGC	1 cut(s)	164
Hsp92II	CATG	3 cut(s)	143, 171, 200
HspAI	GCGC	1 cut(s)	178
LpnPI	CCDG	5 cut(s)	15, 55, 87, 206, 280
LweI	GCATC	2 cut(s)	13, 299
MaeI	CTAG	2 cut(s)	146, 281
MaeIII	GTNAC	1 cut(s)	15
MhlI	GDGCHC	1 cut(s)	175
MluCI	AATT	2 cut(s)	44, 238
MnlI	CCTC	3 cut(s)	18, 118, 210
Mph1103I	ATGCAT	1 cut(s)	6
MseI	TTAA	1 cut(s)	228
MvnI	CGCG	1 cut(s)	180
MwoI	GCNNNNNNNGC	1 cut(s)	164
NlaIII	CATG	3 cut(s)	143, 171, 200
NsiI	ATGCAT	1 cut(s)	6
NspI	RCATGY	1 cut(s)	200
PstNI	CAGNNNCTG	1 cut(s)	164
RsaI	GTAC	1 cut(s)	293
RsaNI	GTAC	1 cut(s)	292
SaqAI	TTAA	1 cut(s)	228
SduI	GDGCHC	1 cut(s)	175
SetI	ASST	2 cut(s)	106, 291
SfaNI	GCATC	2 cut(s)	13, 299
SpeI	ACTAGT	1 cut(s)	145
Sse9I	AATT	2 cut(s)	44, 238
SsiI	CCGC	1 cut(s)	107
SspMI	CTAG	2 cut(s)	146, 281
TaqI	TCGA	2 cut(s)	135, 268
TasI	AATT	2 cut(s)	44, 238
TatI	WGTACW	1 cut(s)	291
Tru1I	TTAA	1 cut(s)	228
Tru9I	TTAA	1 cut(s)	228
TspDTI	ATGAA	2 cut(s)	93, 156
TspGWI	ACGGA	1 cut(s)	137
XapI	RAATTY	1 cut(s)	238
XceI	RCATGY	1 cut(s)	200
XspI	CTAG	2 cut(s)	146, 281
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.