Rmu_sc0004077.1_g000002

Protein phosphatase 2C

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004077.1
OG0018206
Physical Location & Seq
Forward (+)
5698 .. 10064
4367 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004077.1_g000002.1.cds

Sequence Viewer

Length: 1671 bp
atgctgccggggctagctgcttcccggatcccactcctcccagtaatcaccgcctacctccgatggtgtaccaacagtaaattggcccaccgacagagccctagcagcgccagactacgctcaatagacgcactgcctccgaaatatgtgataatgatcgaccaatcatcatctcctttgtcacggtatctctcttgggttgggtctctttttgcgacaattcagagcatttaccatcacacccaaggccagatcaagtcgaatgtaaaaaggcgggtttttgagcagcatggtgaagaaaactatgaagcaaagaatttggcacataccataagctgccaagacagtaacagtaagatgaaagaaaagaatgaagataaaaaaggcatgcatggaatactgcatagttcacaaaagaagtctggtctttcgggtaatagagggagtgctatcaatagtaagttgcgagtgaggcctgcgaagctgtttgtgcctgatttttgtccaaggcaggagttcattgaaatgggactaaagaagttgaaagaggacaaaaaggaatttgaggtggaagggagggatttctgcttggcaagtaagaaaggtgctagaagggagttcatggaagatgggcacagagaaatggttgacataatgggagatcccaagcaggcattttttgctgtgatcgatgggcacggaggttgtgcagctgctgattatgtagctgaaaatttagggaagaacattatgaaagagcttgaacatgttggagaggatcaagaacatgaattgcagcaggctattcgccaaggctactcagtcacagacaagggcttcctcagtcagggtgtgagcagtggagcatgtgcagccagtgtggtgttgaaggatggagcgctacatgtagcaaatttaggagattgtagagtagttttgagtaacaaaggagtagcacatgtattaacaaaagaccaccgtttgagtagtgaagatgagcgtctccgaatcgaaaacaccggtggctttgtgcaacattgccgcaacggagtttggagacttcaaggctcacttgcagtttctagagcaattggggatcaacatttgaaagattgggtcatttccgaaccagaaactaaaacgattcctctaactccagattgcgagttcttgctaatggcttcggatggcttgtgggacaaggtagatgatcaagaggcagtgaatgtggttttaaaagagaaggactcactaaagtcttgcaagaagcttgtgaatatgtcttcaagcagagggagcatggatgacataactgttatggtgatcaaccttcgaagctttttggctgctgatcatcttccctggtcaacagtcacttttctgcgtgggcgtgccagcaccgttcgggtgtggtcgtcgggggtgtcccttgacctgacttcttttcagcgattgaggacgaggagagcaccaacctcgtcgccggattctttgtgcctcgtgctctcgaggagactaggaccgaagcactttgacagagggtttggtggcactgatagtcggctcctgagaagactaggactggagtgtgatcaccgggcattaccattgcttggctggttctgtaaccgttgtggtcatggcactaccgtcggctcccgaggagactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PP2C

Protein Analysis

556

Amino Acids

61.79

Weight (kDa)

9.11

Isoelectric Point (pI)

47.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018206)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0251221
rosa_laevigata RLG00000015473
rosa_multiflora Rmu_sc0004077.1_g000002
rosa_roxburghii Rroxscaffold_7G00216910
rosa_rugosa Rorug05G0500800
rosa_samantha Rh6AG010200 Rh6BG001800 Rh6CG007200 Rh6DG007700
rosa_wichuraiana Rw6G001000 Rw6G001110

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 1613
AciI CCGC 3 cut(s) 51, 274, 1042
AclWI GGATC 5 cut(s) 22, 35, 656, 786, 1104
AcsI RAATTY 4 cut(s) 316, 560, 733, 913
AfaI GTAC 1 cut(s) 70
AfeI AGCGCT 1 cut(s) 900
AfiI CCNNNNNNNGG 2 cut(s) 847, 1613
AflIII ACRYGT 3 cut(s) 766, 904, 958
AgeI ACCGGT 1 cut(s) 1019
AgsI TTSAA 7 cut(s) 524, 544, 764, 889, 1064, 1108, 1287
AjnI CCWGG 1 cut(s) 1361
AluBI AGCT 8 cut(s) 17, 336, 484, 713, 728, 760, 1270, 1338
AluI AGCT 8 cut(s) 17, 336, 484, 713, 728, 760, 1270, 1338
Alw21I GWGCWC 2 cut(s) 1471, 1506
Alw26I GTCTC 5 cut(s) 210, 1007, 1051, 1507, 1659
AlwI GGATC 5 cut(s) 22, 35, 656, 786, 1104
AlwNI CAGNNNCTG 1 cut(s) 716
Ama87I CYCGRG 2 cut(s) 1507, 1659
Aor51HI AGCGCT 1 cut(s) 900
AoxI GGCC 3 cut(s) 84, 247, 473
ApoI RAATTY 4 cut(s) 316, 560, 733, 913
ArsI GACNNNNNNTTYG 2 cut(s) 1526, 1558
AsiGI ACCGGT 1 cut(s) 1019
AspLEI GCGC 2 cut(s) 110, 901
AspS9I GGNCC 2 cut(s) 85, 1520
AsuC2I CCSGG 3 cut(s) 9, 25, 1598
AsuHPI GGTGA 4 cut(s) 40, 305, 1333, 1586
AsuII TTCGAA 1 cut(s) 1333
AsuNHI GCTAGC 1 cut(s) 13
AvaI CYCGRG 2 cut(s) 1507, 1659
AvaII GGWCC 1 cut(s) 1520
BaeGI GKGCMC 2 cut(s) 636, 699
BamHI GGATCC 1 cut(s) 27
BanII GRGCYC 1 cut(s) 101
BauI CACGAG 1 cut(s) 1499
BbsI GAAGAC 2 cut(s) 1275, 1579
Bbv12I GWGCWC 2 cut(s) 1471, 1506
BbvI GCAGC 9 cut(s) 4, 117, 298, 323, 700, 722, 808, 884, 1333
BccI CCATC 6 cut(s) 57, 243, 623, 686, 887, 1181
BcgI CGANNNNNNTGC 6 cut(s) 788, 822, 1458, 1492, 1633, 1667
BciT130I CCWGG 1 cut(s) 1363
BclI TGATCA 4 cut(s) 1210, 1323, 1351, 1591
BcnI CCSGG 3 cut(s) 9, 25, 1598
BcoDI GTCTC 5 cut(s) 210, 1007, 1051, 1507, 1659
BfaI CTAG 7 cut(s) 14, 102, 609, 1083, 1517, 1577, 1669
BfoI RGCGCY 2 cut(s) 111, 902
Bme1390I CCNGG 4 cut(s) 9, 25, 1363, 1598
Bme18I GGWCC 1 cut(s) 1520
BmeT110I CYCGRG 2 cut(s) 1507, 1659
BmgT120I GGNCC 2 cut(s) 85, 1520
BmiI GGNNCC 3 cut(s) 29, 1565, 1657
BmrFI CCNGG 4 cut(s) 9, 25, 1363, 1598
BmrI ACTGGG 1 cut(s) 35
BmtI GCTAGC 1 cut(s) 17
BmuI ACTGGG 1 cut(s) 35
BpiI GAAGAC 2 cut(s) 1275, 1579
BplI GAGNNNNNCTC 2 cut(s) 1232, 1264
BpmI CTGGAG 2 cut(s) 1140, 1604
Bpu14I TTCGAA 1 cut(s) 1333
BpuMI CCSGG 3 cut(s) 9, 25, 1598
Bsa29I ATCGAT 1 cut(s) 690
BsaBI GATNNNNATC 1 cut(s) 155
BsaI GGTCTC 1 cut(s) 210
BsaJI CCNNGG 6 cut(s) 8, 244, 506, 811, 1361, 1660
BsaWI WCCGGW 1 cut(s) 1019
Bsc4I CCNNNNNNNGG 2 cut(s) 847, 1613
Bse118I RCCGGY 1 cut(s) 1019
Bse1I ACTGG 3 cut(s) 41, 876, 1587
Bse3DI GCAATG 2 cut(s) 1036, 1607
Bse8I GATNNNNATC 1 cut(s) 155
BseBI CCWGG 1 cut(s) 1363
BseCI ATCGAT 1 cut(s) 690
BseDI CCNNGG 6 cut(s) 8, 244, 506, 811, 1361, 1660
BseGI GGATG 3 cut(s) 898, 1192, 1309
BseJI GATNNNNATC 1 cut(s) 155
BseLI CCNNNNNNNGG 2 cut(s) 847, 1613
BseMI GCAATG 2 cut(s) 1036, 1607
BseMII CTCAG 3 cut(s) 834, 856, 1559
BseNI ACTGG 3 cut(s) 41, 876, 1587
BseRI GAGGAG 3 cut(s) 26, 1477, 1525
BseSI GKGCMC 2 cut(s) 636, 699
BseXI GCAGC 9 cut(s) 4, 117, 298, 323, 700, 722, 808, 884, 1333
BsgI GTGCAG 2 cut(s) 729, 891
BshFI GGCC 3 cut(s) 86, 249, 475
BshTI ACCGGT 1 cut(s) 1019
BshVI ATCGAT 1 cut(s) 690
BsiHKAI GWGCWC 2 cut(s) 1471, 1506
BsiHKCI CYCGRG 2 cut(s) 1507, 1659
BsiSI CCGG 5 cut(s) 8, 25, 1020, 1484, 1597
BslFI GGGAC 3 cut(s) 543, 1211, 1411
BslI CCNNNNNNNGG 2 cut(s) 847, 1613
BsmAI GTCTC 5 cut(s) 210, 1007, 1051, 1507, 1659
BsmBI CGTCTC 1 cut(s) 1007
BsmFI GGGAC 3 cut(s) 543, 1211, 1411
BsnI GGCC 3 cut(s) 86, 249, 475
Bso31I GGTCTC 1 cut(s) 210
BsoBI CYCGRG 2 cut(s) 1507, 1659
Bsp119I TTCGAA 1 cut(s) 1333
Bsp1286I GDGCHC 5 cut(s) 101, 636, 699, 1471, 1506
BspACI CCGC 3 cut(s) 51, 274, 1042
BspANI GGCC 3 cut(s) 86, 249, 475
BspCNI CTCAG 3 cut(s) 833, 855, 1560
BspDI ATCGAT 1 cut(s) 690
BspLI GGNNCC 3 cut(s) 29, 1565, 1657
BspOI GCTAGC 1 cut(s) 17
BspPI GGATC 5 cut(s) 22, 35, 656, 786, 1104
BspT104I TTCGAA 1 cut(s) 1333
BspTNI GGTCTC 1 cut(s) 210
BsrDI GCAATG 2 cut(s) 1036, 1607
BsrFI RCCGGY 1 cut(s) 1019
BsrI ACTGG 3 cut(s) 41, 876, 1587
BssAI RCCGGY 1 cut(s) 1019
BssECI CCNNGG 6 cut(s) 8, 244, 506, 811, 1361, 1660
BssSI CACGAG 1 cut(s) 1499
BssT1I CCWWGG 3 cut(s) 244, 506, 811
Bst2BI CACGAG 1 cut(s) 1499
Bst2UI CCWGG 1 cut(s) 1363
BstAPI GCANNNNNTGC 1 cut(s) 680
BstBI TTCGAA 1 cut(s) 1333
BstC8I GCNNGC 7 cut(s) 15, 389, 477, 672, 801, 1392, 1396
BstDEI CTNAG 3 cut(s) 820, 842, 1568
BstENI CCTNNNNNAGG 1 cut(s) 845
BstF5I GGATG 3 cut(s) 898, 1192, 1309
BstH2I RGCGCY 2 cut(s) 111, 902
BstHHI GCGC 2 cut(s) 110, 901
BstMAI GTCTC 5 cut(s) 210, 1007, 1051, 1507, 1659
BstMWI GCNNNNNNNGC 8 cut(s) 10, 105, 472, 481, 490, 680, 872, 1296
BstNI CCWGG 1 cut(s) 1363
BstNSI RCATGY 5 cut(s) 391, 770, 870, 908, 962
BstSCI CCNGG 4 cut(s) 7, 23, 1361, 1596
BstSLI GKGCMC 2 cut(s) 636, 699
BstV1I GCAGC 9 cut(s) 4, 117, 298, 323, 700, 722, 808, 884, 1333
BstV2I GAAGAC 2 cut(s) 1275, 1579
BstX2I RGATCY 2 cut(s) 27, 661
BstYI RGATCY 2 cut(s) 27, 661
Bsu15I ATCGAT 1 cut(s) 690
BsuRI GGCC 3 cut(s) 86, 249, 475
BsuTUI ATCGAT 1 cut(s) 690
BtsCI GGATG 3 cut(s) 898, 1192, 1309
BtsI GCAGTG 3 cut(s) 131, 865, 1227
BtsIMutI CAGTG 5 cut(s) 131, 865, 883, 1227, 1551
Cac8I GCNNGC 7 cut(s) 15, 389, 477, 672, 801, 1392, 1396
CaiI CAGNNNCTG 1 cut(s) 716
CfoI GCGC 2 cut(s) 110, 901
Cfr10I RCCGGY 1 cut(s) 1019
Cfr13I GGNCC 2 cut(s) 85, 1520
ClaI ATCGAT 1 cut(s) 690
CseI GACGC 2 cut(s) 137, 989
Csp6I GTAC 1 cut(s) 69
CspAI ACCGGT 1 cut(s) 1019
CviQI GTAC 1 cut(s) 69
DdeI CTNAG 3 cut(s) 820, 842, 1568
DraI TTTAAA 1 cut(s) 1236
Eco130I CCWWGG 3 cut(s) 244, 506, 811
Eco147I AGGCCT 1 cut(s) 475
Eco24I GRGCYC 1 cut(s) 101
Eco31I GGTCTC 1 cut(s) 210
Eco47I GGWCC 1 cut(s) 1520
Eco47III AGCGCT 1 cut(s) 900
Eco88I CYCGRG 2 cut(s) 1507, 1659
EcoNI CCTNNNNNAGG 1 cut(s) 845
EcoRII CCWGG 1 cut(s) 1361
EcoT14I CCWWGG 3 cut(s) 244, 506, 811
EcoT22I ATGCAT 1 cut(s) 393
EcoT38I GRGCYC 1 cut(s) 101
ErhI CCWWGG 3 cut(s) 244, 506, 811
Esp3I CGTCTC 1 cut(s) 1007
FalI AAGNNNNNCTT 2 cut(s) 1056, 1088
FaqI GGGAC 3 cut(s) 543, 1211, 1411
FauI CCCGC 1 cut(s) 267
FbaI TGATCA 4 cut(s) 1210, 1323, 1351, 1591
FokI GGATG 3 cut(s) 905, 1199, 1316
FriOI GRGCYC 1 cut(s) 101
FspBI CTAG 7 cut(s) 14, 102, 609, 1083, 1517, 1577, 1669
GlaI GCGC 2 cut(s) 109, 900
GsuI CTGGAG 2 cut(s) 1140, 1604
HaeII RGCGCY 2 cut(s) 111, 902
HaeIII GGCC 3 cut(s) 86, 249, 475
HapII CCGG 5 cut(s) 8, 25, 1020, 1484, 1597
HgaI GACGC 2 cut(s) 137, 989
HhaI GCGC 2 cut(s) 110, 901
Hin6I GCGC 2 cut(s) 108, 899
HinP1I GCGC 2 cut(s) 108, 899
HincII GTYRAC 2 cut(s) 649, 1368
HindII GTYRAC 2 cut(s) 649, 1368
HindIII AAGCTT 2 cut(s) 1268, 1336
HinfI GANTC 4 cut(s) 1008, 1144, 1247, 1487
HpaII CCGG 5 cut(s) 8, 25, 1020, 1484, 1597
HphI GGTGA 4 cut(s) 40, 305, 1333, 1586
Hpy166II GTNNAC 4 cut(s) 69, 410, 649, 1368
Hpy188I TCNGA 6 cut(s) 62, 141, 225, 1007, 1126, 1186
Hpy188III TCNNGA 7 cut(s) 782, 1083, 1157, 1214, 1507, 1567, 1659
Hpy8I GTNNAC 4 cut(s) 69, 410, 649, 1368
Hpy99I CGWCG 3 cut(s) 1420, 1483, 1655
HpyAV CCTTC 5 cut(s) 566, 606, 883, 1237, 1340
HpyCH4V TGCA 8 cut(s) 391, 403, 710, 796, 872, 1033, 1076, 1263
HpyF10VI GCNNNNNNNGC 8 cut(s) 10, 105, 472, 481, 490, 680, 872, 1296
HpyF3I CTNAG 3 cut(s) 820, 842, 1568
HspAI GCGC 2 cut(s) 108, 899
Ksp22I TGATCA 4 cut(s) 1210, 1323, 1351, 1591
LmnI GCTCC 5 cut(s) 863, 896, 1296, 1569, 1661
Lsp1109I GCAGC 9 cut(s) 4, 117, 298, 323, 700, 722, 808, 884, 1333
MaeI CTAG 7 cut(s) 14, 102, 609, 1083, 1517, 1577, 1669
MaeIII GTNAC 6 cut(s) 180, 347, 823, 941, 1372, 1625
MboII GAAGA 8 cut(s) 308, 386, 638, 754, 1004, 1275, 1349, 1584
MfeI CAATTG 1 cut(s) 1089
MflI RGATCY 2 cut(s) 27, 661
MhlI GDGCHC 5 cut(s) 101, 636, 699, 1471, 1506
MluCI AATT 8 cut(s) 80, 219, 316, 560, 733, 791, 913, 1089
MlyI GAGTC 1 cut(s) 1241
MmeI TCCRAC 1 cut(s) 751
Mph1103I ATGCAT 1 cut(s) 393
MseI TTAA 2 cut(s) 965, 1235
MslI CAYNNNNRTG 1 cut(s) 524
MspA1I CMGCKG 1 cut(s) 713
MspI CCGG 5 cut(s) 8, 25, 1020, 1484, 1597
MspR9I CCNGG 4 cut(s) 9, 25, 1363, 1598
MunI CAATTG 1 cut(s) 1089
MvaI CCWGG 1 cut(s) 1363
MwoI GCNNNNNNNGC 8 cut(s) 10, 105, 472, 481, 490, 680, 872, 1296
NciI CCSGG 3 cut(s) 9, 25, 1598
NheI GCTAGC 1 cut(s) 13
NlaIV GGNNCC 3 cut(s) 29, 1565, 1657
NmuCI GTSAC 3 cut(s) 180, 823, 1372
NsiI ATGCAT 1 cut(s) 393
NspI RCATGY 5 cut(s) 391, 770, 870, 908, 962
NspV TTCGAA 1 cut(s) 1333
PaeI GCATGC 1 cut(s) 391
PaeR7I CTCGAG 1 cut(s) 1507
PceI AGGCCT 1 cut(s) 475
PciI ACATGT 3 cut(s) 766, 904, 958
PfeI GAWTC 3 cut(s) 1008, 1144, 1487
PflMI CCANNNNNTGG 1 cut(s) 1613
PfoI TCCNGGA 1 cut(s) 23
PinAI ACCGGT 1 cut(s) 1019
PleI GAGTC 1 cut(s) 1241
PpsI GAGTC 1 cut(s) 1241
PscI ACATGT 3 cut(s) 766, 904, 958
Psp6I CCWGG 1 cut(s) 1361
PspGI CCWGG 1 cut(s) 1361
PspN4I GGNNCC 3 cut(s) 29, 1565, 1657
PspPI GGNCC 2 cut(s) 85, 1520
PstNI CAGNNNCTG 1 cut(s) 716
PsuI RGATCY 2 cut(s) 27, 661
PvuII CAGCTG 1 cut(s) 713
RsaI GTAC 1 cut(s) 70
RsaNI GTAC 1 cut(s) 69
RseI CAYNNNNRTG 1 cut(s) 524
SaqAI TTAA 2 cut(s) 965, 1235
Sau96I GGNCC 2 cut(s) 85, 1520
SchI GAGTC 1 cut(s) 1241
ScrFI CCNGG 4 cut(s) 9, 25, 1363, 1598
SduI GDGCHC 5 cut(s) 101, 636, 699, 1471, 1506
Sfr274I CTCGAG 1 cut(s) 1507
SfuI TTCGAA 1 cut(s) 1333
SgrAI CRCCGGYG 1 cut(s) 1019
SinI GGWCC 1 cut(s) 1520
SlaI CTCGAG 1 cut(s) 1507
SmiMI CAYNNNNRTG 1 cut(s) 524
SmlI CTYRAG 1 cut(s) 1507
SmoI CTYRAG 1 cut(s) 1507
SphI GCATGC 1 cut(s) 391
Sse9I AATT 8 cut(s) 80, 219, 316, 560, 733, 791, 913, 1089
SseBI AGGCCT 1 cut(s) 475
SsiI CCGC 3 cut(s) 51, 274, 1042
SspMI CTAG 7 cut(s) 14, 102, 609, 1083, 1517, 1577, 1669
StuI AGGCCT 1 cut(s) 475
StyD4I CCNGG 4 cut(s) 7, 23, 1361, 1596
StyI CCWWGG 3 cut(s) 244, 506, 811
TaqI TCGA 6 cut(s) 159, 260, 690, 1011, 1333, 1508
TaqII GACCGA 1 cut(s) 1537
TasI AATT 8 cut(s) 80, 219, 316, 560, 733, 791, 913, 1089
TauI GCSGC 1 cut(s) 1044
TfiI GAWTC 3 cut(s) 1008, 1144, 1487
Tru1I TTAA 2 cut(s) 965, 1235
Tru9I TTAA 2 cut(s) 965, 1235
TscAI CASTG 5 cut(s) 138, 865, 883, 1227, 1558
TseFI GTSAC 3 cut(s) 180, 823, 1372
Tsp45I GTSAC 3 cut(s) 180, 823, 1372
TspDTI ATGAA 7 cut(s) 321, 374, 387, 508, 610, 767, 804
TspGWI ACGGA 2 cut(s) 714, 1062
TspRI CASTG 5 cut(s) 138, 865, 883, 1227, 1558
Van91I CCANNNNNTGG 1 cut(s) 1613
VpaK11BI GGWCC 1 cut(s) 1520
XagI CCTNNNNNAGG 1 cut(s) 845
XapI RAATTY 4 cut(s) 316, 560, 733, 913
XbaI TCTAGA 1 cut(s) 1082
XceI RCATGY 5 cut(s) 391, 770, 870, 908, 962
XcmI CCANNNNNNNNNTGG 2 cut(s) 79, 1614
XhoI CTCGAG 1 cut(s) 1507
XspI CTAG 7 cut(s) 14, 102, 609, 1083, 1517, 1577, 1669
Zsp2I ATGCAT 1 cut(s) 393
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.